Reflective writing during nursing clinical placement Essay

Intelligent composition during nursing clinical situation - Essay Example It was a night move in mishap and crisis area. I was helping my guide, the head nurture in An and E segment. An adolescent was acquired by the clinical staff, he was thin and feeble, halfway in condition of suspicion, and had stains of regurgitation on his shirt. The individual, who got the youngster, revealed to us that they have discovered this addict from suburbia of the city. He was gotten by the police for utilizing amphetamine in people in general. My tutor revealed to me that it was a trial of nerves to care for medicate abusers. Their states change widely, and discover what medication has been utilized, and what was the most clear method of admission of that sedate. She anticipated that amphetamine was ingested orally by this patient, so we needed to clean out his stomach by utilizing actuated charcoal.The reason for initiated charcoal is to expel amphetamine from GI by heaving (Amphetamine.com, 2014). Diazepam and Lorazepam are utilized to quiet down the patient. To recupera te lack of hydration intravenous infusion of liquids might be utilized (Lewis, et al., 2013). Hyperthermia is constrained by utilizing downers and ice packs. Intravenous diazepam is managed during amphetamine overdose when seizures are available. For hypertension nitroglycerin and labetol is suggested . On the off chance that the condition of the patient is in harm's way, serotonin harmfulness must be directed (Amphetamine.com, 2014). Medication addicts are difficult to oversee, it isn't just their physiological express that should be thought of, however their mental state should likewise be considered.

Spelling and Sound Challenges to Spanish L2 Learners of English

Spelling and Sound Challenges to Spanish L2 Learners of English Dynamic Learning a subsequent language is typically a troublesome assignment for a great many people. This is on the grounds that; every language has its own shows, which are not really like those of the second language one is attempting to gain. For local Spanish speakers attempting to learn English as a subsequent language, various difficulties might be present.Advertising We will compose a custom report test on Spelling and Sound Challenges to Spanish L2 Learners of English explicitly for you for just $16.05 $11/page Learn More In the writing audit, spelling and sound framework in the English language will be tended to as the most widely recognized test experienced by Spanish students of English as a subsequent language. Issues emerging from spelling and sound could be identified with challenges in way to express words, learning of English jargon, language structure and spelling of words. Way to express English words for local Spanish speakers might be an issue as a result of cert ain words which start with a specific sound for instance ‘s’, being articulated in an alternate path in the Spanish language. Since it is extremely normal for a student to reproduce the shows of their language into the second language they are learning, it might be hard for them to comprehend the elocution. Once more, learning of jargon might be troublesome in view of words present in the two dialects which seem to have a similar spelling however unique significance. The punctuation and the spelling of words follow various shows in the English language. In the systems segment, determination of members, information assortment strategies and methodology utilized will be tended to. The consequences of this report will at that point be broke down and from that point, a conversation and end will follow. Presentation Those who communicate in Spanish as their first language have a few points of interest when learning English as a subsequent language. One of the preferences is that, local Spanish speakers learn English jargon quicker on account of the various similitudes that exist among words in the two dialects. All things considered, there are some particular troubles that local Spanish speakers experience while learning English as a subsequent language. A portion of these issues are found in the territory of spelling and sound while learning English. The greater part of the students will experience issues in these two territories in view of the differences that exist between the Spanish and the English language in spelling and sound example of words.Advertising Looking for report on etymology? How about we check whether we can support you! Get your first paper with 15% OFF Learn More Literature Review Pronunciation Difficulties According to Farnen (2010), local Spanish learning English as a subsequent language experience troubles in learning English elocutions. This is on the grounds that, the there are various contrasts that exists in the way to expr ess words in the dialects. The English language involves twelve vowels. There are likewise eight diphthongs. Then again, the Spanish language has just five vowels and five diphthongs. Due this foundation, whereby one knows about just five diphthongs and vowels, it turns out to be difficult for such an individual to learn English, which has various vowels and diphthongs. One test that local Spanish speakers experience in the region of elocution is recognizing words in English that have comparable articulation however extraordinary spelling, particularly in view of the vowels or diphthongs utilized. For exampled, the words ‘beat’ and ‘bit’ word be trying for a Spanish speaker to recognize. Also, Farnen (2010) states that disarray of consonants may emerge. Some English consonants, for example, ‘S’ might be mistaken for ‘Z’. Subsequently, the English word ‘Sue’ may wind up being articulated as ‘Zoo’. Once more , disarray between the consonants ‘b’ and ‘v’ is normal. The other sound that is tricky to local Spanish speakers learning English as a subsequent language is way to express the underlying sound ‘s’ in English words, for example, ‘solar’. This is principally on the grounds that in the Spanish language, the underlying ‘S’ sound in the start of words is constantly gone before by a ‘e’ sound. The word ‘solar’ in English would wind up being articulated as ‘esolar’ by local Spanish speakers learning English. The underlying ‘S’ sound in word’s beginnings will consistently give them issues. As indicated by Farnen (2010), there is additionally a variety in the cadence of syllables in words. This is on the grounds that, in the Spanish language, all syllables have an equivalent length. In any case, in English, there are emphasized syllables, which are given more term con trasted with different syllables. This reality can be hard to comprehend for the local Spanish speakers who utilize an even beat in communicating in English.Advertising We will compose a custom report test on Spelling and Sound Challenges to Spanish L2 Learners of English explicitly for you for just $16.05 $11/page Learn More Difficulty in learning jargon Skehan (1991) sees that there are numerous words in both English and Spanish dialects that are comparative. This similitude in countless jargon works both for and against an individual learning English as a subsequent language. A few words that show up in both the English the Spanish language may confound the student, since they are not the equivalent in their importance. Instances of a portion of those words that may seem, by all accounts, to be the equivalent however in genuine sense are exclude the English ‘exit’ and Spanish ‘exito’. What is more is that some Germanic segments which exist in the English language may give the Spanish student a great deal of challenges in acing the language. A case of the Germanic segment found in the English language is the phrasal action word ‘look for’. Germanic inferred segments found in the English language are progressively hard for the Spanish speaker to converge than French determined segments. Troubles in Grammar Learning English language for local speakers is one of the most troublesome undertakings. This is a direct result of the disarray that consistently emerges during learning. Especially, there is an issue with relating the action word endings in Spanish with those in English. As indicated by Hinkel (2011), action words in the Spanish language have more action word endings contrasted with action words in the English language, which represents a test to the Spanish students in understanding the English action words. In the English language, a significant and complete sentence consistently involves a subject, action word an d an item. In any case, a total sentence in the Spanish language doesn't generally require a subject to be finished. Subsequently, Spanish students of English as a subsequent language wind up overlooking the subject or subject pronouns in English sentences when composing or talking. They are influenced by the Spanish word request, which they will in general recreate in their English sentences, rather than the regular subject-action word object sentence structure required in an English sentence. Swan Smith (2001) note that: another issue emerges when they are required to frame negatives just as questions utilizing the helping action word ‘do’. This is chiefly in light of the fact that in the Spanish language, the utilization of the helping action word ‘do’ isn't vital so as to frame questions and negatives.Advertising Searching for report on phonetics? How about we check whether we can support you! Get your first paper with 15% OFF Find out More Third individual particular possessive descriptive words, which require the utilization of the right sexual orientation all together for the sentence to be right, are a significant test to Spanish students of English. This is on the grounds that in the English language, there is separation of the sexual orientations as an outsider looking in solitary possessive descriptive word, while in Spanish, this isn't the situation. There is just a single third individual solitary possessive descriptor that can be utilized for the English her, his and its. Troubles in spelling and accentuation According to Shatz and Wilkinson (2010), local Spanish speakers experience a great deal of issues in spelling English words accurately. This is on the grounds that the local Spanish speakers know about Spanish, which is a language with more framework when contrasted with the English language. Words in the English language which have a similar sound can be spelt diversely however in Spanish, a similar soun d is consistently spelt similarly in all words. For instance, the English sound/f/can be spelt in an unexpected way, for instance,/gh/as in ‘cough’, and/f/as in ‘floor’. In any case, in the Spanish language, such a sound would just have a solitary spelling. This makes it hard for the local speakers to see how a similar sound can be spelt diversely in English words. The numerous vowels and diphthongs present in the English language represent a significant test to the Spanish students. The utilization of accentuation checks in sentences and in words is additionally confounding for local Spanish speakers. Troubles in realizing where to put outcry stamps or question marks result to off base sentences. The Spanish students tend to put these accentuation marks at an inappropriate places for instance toward the start or toward the finish of sentences. This happens for the most part recorded as a hard copy. The local Spanish speakers have additionally an issue in i nterfacing sentences genuinely. This is on the grounds that they will in general use commas to interface free provisos in sentences, which results to wrong sentence structures. System Participants Twenty members were chosen arbitrarily. The members were looked over Spanish local speakers who were learning English as a subsequent language. Materials The substance from books which handle the subject of troubles encou

SUDs Rating Scale for Measuring Social Anxiety

SUDs Rating Scale for Measuring Social Anxiety Social Anxiety Disorder Treatment and Therapy Print SUDs Rating Scale for Measuring Social Anxiety By Arlin Cuncic Arlin Cuncic, MA, is the author of Therapy in Focus: What to Expect from CBT for Social Anxiety Disorder and 7 Weeks to Reduce Anxiety. Learn about our editorial policy Arlin Cuncic Medically reviewed by Medically reviewed by Steven Gans, MD on August 05, 2016 Steven Gans, MD is board-certified in psychiatry and is an active supervisor, teacher, and mentor at Massachusetts General Hospital. Learn about our Medical Review Board Steven Gans, MD Updated on February 21, 2020 Social Anxiety Disorder Overview Symptoms & Diagnosis Causes Treatment Living With In Children Flynn Larsen/Cultura/Getty Images The SUDs Rating Scale, or Subjective Units of Distress Scale (SUDs) as it is officially known, is used to measure the intensity of distress or nervousness in people with  social anxiety. The SUDs is a self-assessment tool rated on a scale from 0 to 100.?? The SUDs can be a subjective  tool used by your therapist or healthcare  provider to evaluate your progress and the success of your current treatment plan. In this way, it can be used regularly over the months of your treatment to gauge different areas of disturbance that require additional work. SUDs Rating Process A common technique in cognitive therapy is using the SUDs tool to gauge your distress or emotional state. Guidelines for the SUDs include rating the intensity of your anxiety as it is experienced in the moment and while tightening or tensing of the body.?? Below is a simplified version of the scale with different guide points: Rating Your Distress 100: Unbearably upset to the point that you cannot function and may be on the verge of a breakdown90: Extremely anxious and desperate, helpless and unable to handle it80: Worried and panicky; losing focus and feeling anxious in the body70: Discomfort dominates your thoughts and you struggle to function normally60: Strong levels of discomfort 50: Upset and uncomfortable; still functional40: Moderate anxiety and worry30: Worried or upset; still able to function20: A little bit sad or distressed10: No distress; alert and focused0: Peace and complete calm Precise accuracy of measurement is not important. Rather, the SUDs is a broad guide to give your therapist an idea of what you are experiencing. It is especially important to share this with your therapist because it reflects how you feel about your distress, rather than how anyone else judges your fears. It can be difficult to share with your therapist the intensity of what you are feeling. In this way, the SUDs gives you a simple way to express the severity of your emotions. The 6 Types of Basic Emotions It is common for those with social anxiety to feel emotions and fears more intensely than others.?? What could be a minor incident to someone else can feel like a catastrophe to you. Social anxiety influences your perspective and how you view yourself and those around you. SUDs and Therapy Use of the SUDs  can help you and your therapist  track improvements or setbacks. Be sure to complete the scale honestly to allow your therapist to appropriately judge what is working and what is not. Through the SUDs scale, you may realize you feel intensely distressed by something that wouldnt bother others. This can help you identify areas you need to work on. As you go through the SUDs assessment, you can identify areas to work on with your therapist. Your therapist may have you work through techniques such as disputation, during which you recognize  irrational thoughts and work to replace them with more rational ways of looking at situations.?? This is a learned skill that you establish during therapy, but continue to develop on your own in your daily routine. You may find that working through these issues improves your SUDs rating. What Is Disputation? A Word From Verywell Ratings scales such as the SUDs are only useful if you complete them honestly. Try not to respond in the manner that you think your therapist wants, as this can be a trap for those with social anxiety disorder. Instead, give ratings based on how you are feeling in the moment, regardless of whether you think it is good or bad to be feeling that way. In particular, research on the use of the SUDs with children and teens has shown that miscommunication can sometimes be a problem.?? If you fall into this age range, be sure to tell your therapist or doctor if you are not sure how to complete the SUDs tool. The 7 Best Online Anxiety Support Groups

Essay on Culture and Race Awareness - 1256 Words

What Are Infants Learning about Race? A Look at a Sample of Infants from Multiple Racial Groups (Njoroge, Benton, Lewis, and Njoroge N., 2009). Infant Mental Health Journal, Vol. 30(5), 549-567 (2009). Author’s credentials combined are from various universities and a hospital within the United States. The purpose of the research was to obtain more knowledge regarding the significance of culture and race on the social development of children. A historical theoretical framework of child development combined present studies to analyze how the conveyance of culture and race affect the emergent child. Phenotype toys were presented to infants and children to test their reactions during play. The dependent variable was the†¦show more content†¦The ethnic stimulus items composed of four baby dolls with dissimilar skin tones: two brown and two fair. One pair of fair skin dolls characterized the â€Å"White race doll† and the bronzed skin dolls symbolized the â€Å"Blac k race doll.† Other stimulus play items were a dollhouse, dollhouse particulars, and reading materials (p. 558). Questions presented to older children (24 months) were revised from those asked in the Clark (1947) and Horowitz (1938) studies. For instance, instead of asking the children to select from dolls that bore a strong resemblance to them or which doll they desired the best; Katz and Kofkin’s (1997) questions included in this study were â€Å"Are you a boy or girl?† (p. 558). Included in the current study is data collected from a broader study of 59 children between the ages (6- 84 months) (four were preschoolers from Northeastern United States). (Study dates were from July 2004- March 2006). Age criteria were (6- 84 months) (no ethnicity bias). Sample (32 girls and 26 boys) three boys (5% enrolled but chose not to continue). The final sample was unevenly divided ethnically. The original sample made up 59% (n = 34) Caucasian Americans, 28% (n = 16) African Americans/ African Diaspora, and 14% percent (n = 7) Asian Americans/Southeast Asian. There was a 52% completion rate ou t of 30 parent/guardian consent forms completed (p. 558). Present data presented is on a subset of children (agedShow MoreRelatedEssay Nigrescence Model of Racial Identity Development813 Words   |  4 Pagesdisplays a lack awareness of his/her own race and is uninterested in racial differences (to include those that affect Blacks). This stage delineates two types of identities, namely the â€Å"anti-Black† and â€Å"assimilationâ€Å" clusters. The anti-Black pre-encounter stage represents a cluster of black Americans that take pride in White standards, values, and beliefs; they view the White race and culture as emblems of beauty and perfection. These people hold a high level of hatred for the Black race and openly expressesRead MoreHeightening Awareness On The Importance Of Using Multicultural Literature974 Words   |  4 PagesHEIGHTENING AWARENESS ABOUT THE IMPORTANCE OF USING MULTICULTURAL LITERATURE Heightening Awareness about the Importance of Using Multicultural Literature In their paper, Heightening Awareness about the Importance of Using Multicultural Literature, the authors, Susan A. Colby and Anna F. Lyon, express the importance how teachers should create an awareness on the importance of multicultural literature in today’s classrooms, and how the role of literature of this type plays an important role in theRead MoreRacial Awareness And Racism And Stereotypes1529 Words   |  7 Pagesstudents in a way that can inspire them to accept and understand a range of people and cultures as well as counter racism and stereotypes? It all begins with the educators themselves having an open mind about different races, as they should act as models to the students. I believe that if teachers educate and enlighten their students about race and cultures, it would lower the chances of racism. Racial awareness is key in the early years of education as it allows students to develop more knowledgeRead MoreBlack History After American History900 Words   |   4 Pagesespecially African Americans; therefore, a month was created to raise awareness of their culture and the role they played in American history. There are other minorities such as Latinos and the Gay/Lesbian community who have suffered and played a huge role in American history who deserve an annual celebration of achievements by Mexican Americans. Black History Month has had positive effects it has taught many kids in schools the rich culture of blacks in America, not just America but other western countriesRead MoreRace Is A Group Of Persons Related By Common Descent Or Heredity Essay1602 Words   |  7 PagesThe definition of race is a group of persons related by common descent or heredity. A random classification of modern humans, sometimes based on any or a combination of various physical characteristics; such as skin color, facial form, or eye shape. In social work, we are often taught about individuals cultures and ethnicities in order to improve our practice and competence. Race on the other hand was created based on how people look, rather than their cultural decent, what religion they practiceRead MoreRace As A Social Construct1566 Words   |  7 PagesRachel Marx PHL-137-01 Dr. Wolf March 17, 2017 Race as a Social Construct Charles W. Mills argues that even if there is no biological notion of race that can underwrite our social one, our social one still has some objectivity to it. He provides details for many hypothetical and real life instances in order to back up his argument. My view, along with Mills’, is that race is socially constructed, and has been socially constructed long before I even had an opinion on the topic. I will explore everyRead MoreEssay on Walgreens Diversity Issues1644 Words   |  7 Pagesnoticed all of one race it may make them feel uncomfortable leading to them spending less. As far as employees go the intention of the company is widely spread diversity throughout the company by training through a computer program that explains what is expected from the employees in concern of diversity. At every level, in every context, Walgreens try to reinforce the fact that they want to be an inclusive, welcoming culture. Each position receives training on cultural awareness that teach theirRead More Counseling a Client from Another Culture Essay923 Words   |  4 Pagessurrounded by rich and diverse cultures. Immigrants arriving in this country today are struggling to assimilate and still maintain their own individual identity. For instance, Elizabeth, my mother, was born in Italy and came to the United States when she was 11 years of age. When it was time for my mom to start school, the guidance office recommended to her foster parents remove any clothing, jewelry, or personal items that were not congruent with the American culture at that time. As I reflect o nRead MoreMulticultural Awareness As A Clinical Mental Health Counselor965 Words   |  4 PagesJournal: Multicultural Awareness This paper will introduce and define the need for Multicultural awareness as a clinical mental health counselor. It will further explore examples of various topics in Multicultural counseling such as: Racial and ethnic diversity, gender and social economic status. As a result of this research, in Multicultural awareness, the self-assessment rendered the identity of myself. It allowed me to realize what and who I was as â€Å"other.† In realizing who I was as â€Å"other†, IRead MoreRacial / Cultural Identity Development Model819 Words   |  4 Pagesthe dominant culture. These phases can guide the counselor to a better understanding of their client, although not everyone will fit into one of these phases. Some can be in several of the phases and some may not be in any of the phases. All five phases are guidelines to help a counselor if a client is dealing with racism or oppression. Ideally, once a person has reached the final stage, he or she is able to appreciate a nd respect his or her native culture and the dominant culture (Sue Sue, 2016)

Organizational Culture, Management Philosophy And Ethics

Introduction Organizational culture, management philosophy and ethics in business each have an impact on all areas of the organization; from operations, marketing, and, accounting. No matter the size, industry or level of profitability of an organization, business ethics are one of the most important aspects of long-term success. According to Webster’s dictionary, ethics can be defined as the â€Å"rules of behavior based on ideas about what is morally good and bad† these rules influence every aspect of our society (Investopedia, N.D.) (Webster’s, N.D.). While sometimes overlooked, accounting plays a large role in many organizations. Its importance cannot be overstated. â€Å"Accountants handle a wide range of privileged and sensitive data in their daily tasks. And because they work with numbers that can have repercussions on bonuses and stock prices, taxes, to name a few areas of influence; they may face ethical dilemmas more often than, other people in the organization† such as, marketing, and operations(McDonald,2014). An analysis of the multifaceted role of accountants is not complete without discussing the duty that it owes to the general public. As a profession that has been granted a privileged position in society, accountants as a whole routinely engage, in a wide range of issues which often require that interest of the public be protected. As a result, it is critical that accountants adhere to the highest level of ethical standards. Unfortunately, that hasn’t always beenShow MoreRelatedEssay Organizational Behavior1057 Words   |  5 PagesOrganizational Behavior Organizational behavior: Organizational behavior refers to the attitudes and behavior of the individuals in the organization. Organizational behavior is a inter-disciplinary field of study that draws from many of the behavioral sciences. The goal of organizational behavior is to apply the concepts from the other behavioral sciences to pressing problems that management may be facing, as well as applying organizational behavior to the administrative theory and practicesRead MoreThe Influence of a Companys Leadership and Culture on Its Business Ethics1541 Words   |  6 PagesDiscuss the ways in which a companys leadership and culture influence its business ethics Definition of Organizational Culture Organizational culture refers to the values and behaviors essential in the contribution or development of unique social and psychological environment with reference to an organization. This is an indication that organizational culture is inclusive of the expectations, philosophy, values, and experiences that focus on holding an organization together with the aim of enhancingRead MoreEthical Values And Behaviors Of An Organization941 Words   |  4 PagesSaleem (2014), ethical values and behaviors of an organization are made up of organizations institutionalized philosophies along with the moral ideologies of its members. In addition, the codes of ethics help to enhance the moral reasoning of employees while shaping their behaviors towards morally questioning unethical situations. Organizational leaders are encouraged to build cultures of trust with leadership who establish concerning goals employees pursue y setting examples for others to followRead MoreThe Impact Of Ethical Dimen sion On Job Satisfaction Of Employees1232 Words   |  5 PagesSATISFACTION OF EMPLOYEES Chapter No. 1 Introduction 1.0 Background The need of organizational ethics is becoming more significant for job satisfaction in all businesses. These businesses have to face many ethical issues like social responsibilities, social expectations, fair competition, legal protections and rights. The consistency and maintenance of an organization’s culture enforces the management to take into account the culture and various factors like performance, driving force to work, dedicationRead MoreAnalysis On The Lincoln Electric Company Essay948 Words   |  4 PagesF. Lincoln in 1965. The many college management texts refer to the Lincoln plan as a model of achieving high worker productivity. SUBJECTING THE LINCOLN ELECTRIC COMPANY TO THE ORGANISATIONAL CULTURE ANALYSIS Organizational Culture according to the text book refers to a system of shared assumptions, values, and beliefs that show people what is appropriate and inappropriate behavior†. The Lincoln Electric Company exhibited a number of different organizational behaviors in their different forms ofRead MoreBusiness Ethics And Virtue Ethics1277 Words   |  6 PagesBusiness Ethics and Virtue Ethics There are many things that make a company unique and successful. The liberty of working in an organization in society today is that, companies are filled with many different individuals from all ways of life. It’s these people who bring something new, innovative and exciting to their line of work and often times you will find positively affect the others around them. Within my military profession it is the leadership and the culture of our environment that makesRead MoreCode Of Ethics And Ethics Essay1704 Words   |  7 PagesCode of Ethics Implementation A Code of Ethics is regarded as the written guideline to the moral constitution of an organization ( ). The Code of Ethics (Appendix A) outlines the rights, duties, responsibilities, and a benchmark for the organization and its evaluation (Mihai Alina, 2013). It contains behavioral principles and rules of conduct that aids in the decision-making processes and balances the stakeholders expectations and interests against corporate responsibilityRead MoreWalt Disney Company954 Words   |  4 Pagesemphasis on family entertainment and great talent, passion and dedication from our cast members.† Walt Disney has come a long way, but it is still true to its core mission of providing quality entertainment for people around the world (Walt Disney, Culture). Since its founding in 1923, the Walt Disney Company continues to produce unparallel entertainment experiences leading a diversified international family entertainment and media enterprise (Walt Disney, Company o verview). With its mission to be oneRead MoreEnterprise Rent A Car : Sustaining Organizational Learning And A Strong Culture1526 Words   |  7 PagesSomma Harris Corporate Culture and Organization Enterprise Rent-a-Car: Sustaining Organizational Learning and a Strong Culture Organizational learning helps companies to maintain adaptability and flexibility in the modern business world. A strong culture teaches employees values, views, purpose, belonging, and sense of identity, Enterprise Rent-a-Car strong culture has held the organization together and motivated their employees to do the right thing rather than what is easy. They believe thatRead MoreOrganizational Behavior System in Jgtdsl, Bangladesh1499 Words   |  6 PagesIntroduction: - Organizational Behavior (OB) is the study and application of knowledge about how people, individuals, and groups act in organizations. It does this by taking a system approach. That is, it interprets people-organization relationships in terms of the whole person, whole group, whole organization, and whole social system. Its purpose is to build better relationships by achieving human objectives, organizational objectives, and social objectives Elements of Organizational Behavior:- The

Aristotle’s Virtuous response to Plato’s Theory of Forms Free Essays

string(18) " see in the cave\." Two men, facing a wall, where they delight themselves watching shadows of figures that flit in and around their sight; they are happy and content, yet they do not notice chains in their arms and legs. They have been prisoners of their own room since childhood. A door stand open as sounds of people chattering and making noise go along with the shadowy puppets brought about by a large fire. We will write a custom essay sample on Aristotle’s Virtuous response to Plato’s Theory of Forms or any similar topic only for you Order Now The two men continue to be amused, until such time the one of them breaks away from the chain. His curiosity takes him around the room, exploring things he had never seen, touched and felt before. And then, he ventures outside. He is immediately blinded by the sun, but he regains focus and sees lakes, valleys, mountains and tree; the very things he had seen through the shadow puppets illuminated by light. He feels obliged to return to the room and tell his experiences with his partner. But his partner refuses. He is content. He is ignorant, yet happy. On the other hand. The two chained individuals have no sense of goal or purpose. They rely on their sensual perception of the world and immediately base it as source of their own knowledge. Unknown to them, the outside world of the ideal exists, and they have no sense of duty to overcome their ignorance and to further inquire into the ideal world. This, in a nutshell, is the basic premise of Plato’s Allegory of the Cave which is a part of his dialogues in The Republic. Plato argues in one his tenets on the Theory of Forms that the outside world remains unknowable; that man is compelled to view the ideal or the eidos when he is fed with already subtle images of the real. Man’s contentment is bordered with ignorance that enables him to sit placidly and watch the ‘images’ or shadows that do not ultimately give a perception of the outside world. In contrast, Aristotle’s Nichomachean Ethics provide a clear and definite understanding on the nature of man itself, where man’s ultimate purpose is directed toward the attainment of the good or eudaimonia, which is a state of happiness and greater understanding. The existence of virtue necessitates the individual to conceive of a state which provides personal and wilful understanding of the self in order to ‘know. This state of knowing, in Aristotelian terms, is focused on the idea of happiness. In response to the question, the paper will first discuss the notions brought about by Plato on the subject of Scepticism through an enumeration and explanation of his Theory of Forms, specifically on the Allegory of The Cave that brings about the sceptical challenge posed by Plat o whether the individual has the capability of attaining true knowledge. Consequently, Aristotle’s Nichomachean Ethics will attempt to deliver arguments that may answer the challenges posed on scepticism through a monistic approach on the Theory of Forms contrary to the dualistic conception of the world of Forms and Ideas. In addition, Aristotle’s virtue-based ethical system will also provide explanation toward the individuation of man in making his own choice and achieving true knowledge or happiness. Plato and the Cave As narrated in the aforementioned passages, one of Plato’s main philosophies is on the theory of Forms and Ideas. The Allegory of the Cave sums up one of his numerous epistemological assertions on universals; that is, the complete reliance of a universal tangent in the universe that remains unchanged, thus the existence of the ideal world or the eidos. As narrated in the passage, the work itself is an allegory, meaning that the objects and characters of the story act as symbols that represent one of Plato’s philosophies. The two men in the story (originally described as prisoners) are in a cave since childhood. This implies that man is born ignorant of true knowledge and the world around him. This also reflects Plato’s stewardship with his former mentor, Socrates, wherein the first method of gaining true knowledge is through a clear reaffirmation of own self-ignorance in order to know; I know nothing and therefore I must question to know. In relation to the allegory, the men are also chained to their places; that is, ignorance prevents them of exploring the outside world, to know the ideal. Yet they remained imprisoned to their own ignorance. Second, the images cast by a large fire in the back of the cave symbolize the form; the unreal objects of reality that merely provides a distorted perception of what is real. These images are reflected by the fire and cast into shadows onto the walls in which the two men happily watch. This symbolization means that the individual only perceive his world as a mere representation of the ideal. For example, to view a plain object, like a chair or an apple, is not to view it as it is; meaning that these objects are mere representations of the ideal world, thus they are only forms of the ideal. Next, there are also ambient noises of shouts and screams that the two prisoners immediately attribute it with the images they are seeing. This implies that sensual experience cannot entirely determine what is real. In order to know, one must question and therefore this precept establishes the foremost principles of rationalism, which is knowledge based on question rather than experience. Further, these men, fed with sounds and images, remain ignorantly happy, and therefore establishes continuity with regards contentment. The chains represent ignorance as it hinders both men of establishing real knowledge. Plato then presents a scenario where one of the men breaks free from his bondage. It takes time though, to walk in and about his place because it is the first time to do such. Man then explores things that he had not seen before – the real of objects of the representations he used to see in the cave. You read "Aristotle’s Virtuous response to Plato’s Theory of Forms" in category "Papers" Outside the cave, he is blinded by the sun, yet regains his focus to see things as they are. He is then compelled to tell his fellow of his experiences. However, his companion is hopelessly happy and content with his ignorance that he refuses to free himself from his bondage. The implications of the following symbolisms represent the hopeless refusal of the chained man from knowing ‘what is real. Instead, he focuses his attention toward the petty illusions of the form; he had hopelessly chained himself with ignorance that provides him with happiness and contentment that he refuses to venture into a whole new different realm. On the other hand, the free m an extricates himself from the illusions brought about the form and ventures hesitatingly toward the ideal. Plato notes the level of unease and difficulty in facing such since man has long been ignorant of the ideal world. Yet through difficulty, the attainment of true knowledge should be the sole reason of overcoming such obstacles. The symbolism of the sun, which blinds the free man as soon he leaves the cave, represents the intellectual illumination brought about by the ideal. This can also be related to a theistic interpretation of Plato’s view on God. The blinding illumination represents ‘greatness’ of the Thus, Plato’s scepticism is unidentified through the notion of man in search of the ideal. Taking from the philosophies of Socrates, Plato’s Theory of Forms argues for a search using rational thought and the mode of questioning in supposition with the sensual experience in attaining knowledge. This thought lies with the notion of sceptical assimilation of knowledge whether it can be attained or not. For Plato, the notion of the Good or the Ideal remains speculative since man’s ignorance prevents him from seeking such. A life in the Golden Mean On the other hand, Aristotle argues ethics is the search for the chief end and final goal in life. Ethical knowledge is not precise compared to mathematics and sciences, but it is a practical discipline in a way that in order to be good or virtuous is not to quantify it as a study but to actually become good or virtuous. Aristotle conceptualized that the highest good is happiness – the universal end of human life. Contrary to Plato’s self-existing good, happiness should be practical rather than abstract or ideal. The Highest Good must be desirable in itself and not for some other good. Happiness is found in the experience of life and work that is unique to humans or the rational soul. The function of human beings is then to do what is inherently human, because to be good is to individuate oneself through the use of reason or logos. To achieve happiness, according to Aristotle, is line with the fulfilment of the natural purpose of the human soul. In addition, Aristotle states that an ethical virtue is a condition between what is in excess or deficient. However, Aristotle did not espouse moral relativism as he assigned certain emotions (hate, envy, jealousy) and certain actions (theft, murder) as intrinsically wrong in spite of different circumstances. In his work, the Nichomachean Ethics, the process to achieve happiness is to find a mean or middle ground between the two polar opposite of a particularly subject. For example, modesty is a middle ground between two emotions. Too much modesty leads to bashfulness and the lack leads to shamelessness. The foundation of the mean between the opposites of behavior is the Golden Mean. Aristotle’s ethics is goal-oriented; that every being has a definite purpose or end. In line with Plato’s thought, both philosophies center itself on the individual and choice. The difference lies with Aristotle’s ethical system wherein his virtues give the character its purpose, as opposed to Plato’s aim of achieving knowledge. As mentioned from book one of the Ethics, â€Å"every art and inquiry, is thought to aim at some good; and for this reason the good has been rightly declared to be that at which all things aim† (Pojman 2007, p. 375). Thus, Aristotle’s primary aim is for the attainment of the good, which all behaviour and action is directed to such. Plato argues for an assertion of knowledge as implied in the allegory, but Aristotle contradicts this argument that the ideal or the ‘good’ is not otherworldly and unattainable but can be achieved through the direction of happiness in an individual’s life. Aristotle defines virtue as excellence, not only in the material, bodily part of man but also of the soul: â€Å"for the good we are seeking was human good and the happiness human happiness. By human excellence we mean not that of the body but that of the soul; and happiness also we call an activity of the soul† (Pojman 2007, p. 382). For Aristotle, the concept of the good is not metaphysical, but rather attainable; a state of excellence motivated by virtue of the soul. This contrasts sharply with Plato’s notion of a self-existing good or the universals (the ideal, eidos). The human mind, according to Aristotle, naturally aligns its thinking toward abstraction and the conception of the form and ideal does not necessitate a separation of these two ‘worlds. ’ Rather, he argues that the attainment of the ideal is equated with the good or happiness and that it can be practically achieved through a life practiced with virtue. On the concept of virtue, Aristotle defines these as excellence on the part of the human soul. However, these virtues may either be in excess or defect that ultimately harms both the body and soul. Let us consider this, that it is in the nature of such things to be destroyed by defect and excess, as we see in the case of strength and health; both excessive and defective exercise destroys the strength and similarly drink or food which is above or below a certain amount destroys the health† (Pojman 2007, p. 384). The same occurrence happens with virtue; a virtuous act cannot be considered if it is in defect or in exces s. For example, fear is a polar opposite of rashness while courage is the mediated virtue. Both defect and excess are considered vice and therefore follows a certain amount of pain. Vice only exists in the bodily understanding of the mind while virtue (courage, temperance, justice) is nobler and man’s duty is to attain such. Moral excellence or virtue is then a mediation between virtue and vice and it through such that man achieves happiness. The Golden Mean, on the other hand, is a mediated state which enables the individual to achieve eudaimonia through virtue, which is a moderate state that separates excess and deficiency. As explained in the aforementioned passages, this balance relies on the understanding of excess or defect. The proper virtues, according to Aristotle, are courage, temperance, truthfulness, among others. These are the mediated forms of vice (courage as a middle ground between foolhardiness and fear). Scepticism Response In relation to the sceptical problems posited by Plato in his Theory of Forms, the arguments is the nature in which knowledge is acquired, which according to Platonic philosophy, is man’s goal – to break free from ignorance and to attain true knowledge. Plato slightly deviates from Socrates’ methods through the conception of the world of the ideal and forms. His challenge of scepticism lies primarily with the senses as explained in the allegory. The sensual experiences of individual cannot entirely guarantee a clear perception of what is real or not. Thus, the sensory images that man experiences everyday represent an ideal form on some outside world. The problem lies with the method of achieving such; that is, actually conceiving of perfect idea of a represented object. For Aristotle on the other hand, he answers this challenge through the conception of his own ideal end of man – achieving happiness. For Aristotle, the dualistic conception of the realm of the form and ideal, though abstract, does not necessarily mean that it is apart. Rather, he argues that both worlds are unified into one stratified substance and the ideal (eudaimonia, happiness) exist in the sensory world that the individual lives around. Thus, he categorizes the different factors of the world that the individual lives around through the conception of virtue and vice. Aristotle’s ethical system solely rely on the individual to conceptualize or to practice virtue in order to achieve happiness. Contrary to Plato’s theory, the assimilation of virtue is entirely attainable through a more practical practice rather than a metaphysical understanding. However, both philosophers share the same ‘struggle’ in achieving the desired state of human consciousness: â€Å"That moral excellence is a mean, then, and in what sense it is so, and that it is a mean between two vices, the one involving excess and deficiency. Hence, it is no easy task to be good. For in everything it is not easy task to find the middle† (Pojman 2007, p. 388). The same amount of effort, as characterized in the allegory, needs to be equally powerful or in this case, needs to have complete understanding on what it is to be in the ‘middle ground. ’ As Aristotle’s goal-centered ethical system, it contrasts with the implication brought by Plato’s allegory wherein there is only an imagined state of ‘escape’ from ignorance rather than a self-proclaimed attempt of defining one’s life. In the allegory, it is clearly presented from the symbolisms that the reader must ‘imagine’ the man escaping from the chains of ignorance in order to view the world of the eidos. Based from this premise, it can be assumed that this freedom of ignorance is through an understanding of the unreal; that one must question in order to know what real knowledge is. Plato’s problem on scepticism lies on the idea whether the ignorant man has the capability to question or understand the unreal objects of impression and further realizes the ideal that which represents it. Aristotle addresses this through the Nichomachean Ethics wherein the individual character and disposition of man is necessary in directing his own life to an objective state of happiness. Contrary to the dualistic notion of the form and ideal, both worlds, according to Aristotle, exists as one and are the world of forms is represented with the vice. Vice is considered a material, worldly state, something that opposes happiness through its polar opposites. Excess of happiness is indulgence and pleasure while the lack of it is melancholy. Both states however, follow a certain amount of pain since it neither provides balance, always an excess or lack. Through the practice of virtue and mediation, the individual experiences eudaimonia through a careful re-examination of action and the application of virtue. The virtuous life does not have pain, defect or excess, since it is mediated in the middle that is carefully suited to one’s individual needs. Aristotle’s idea of happiness is similar to that of Plato’s ideal world. However, Plato’s conception of the ideal remains unachievable, since the individuals response to their own ignorant states already provide them a sense of satisfaction and happiness. For Aristotle, this mediocre sense of happiness is not the final end or purpose of man. Rather, the application of the Nichomachean Ethics provide another greater purpose or end. The theory of forms merely presents a sceptical approach to man’s choice to break free from ignorance. Aristotle answers this problem through a character-oriented approach – that which gives purpose to the individual to totally break away from sensory experience and to question the world around him. A mediated knowledge Therefore, we conclude that Aristotle’s arguments opposing Plato’s Theory of Forms practically answers the sceptical problem of knowledge in Plato’s allegory. The question whether man has the capability to break free from ignorance is answered through an evaluation of personal character and moral beliefs in attaining a redirected good – happiness. Through the valuation of an end object, the individual is then given purpose. This purpose, applied with Plato’s ideologies, gives the ignorant man a sense of responsibility to know and redirect action toward a much nobler purpose. The individual is then not forever condemned with his own ignorance as he has a purpose to fulfil. Thus, the imagined state of freedom from bondage is gone from a wilful acknowledgement of purpose. In Aristotle’s notion, this purpose is directed toward happiness which individuates the being through purpose. These notions can also be based on the succeeding theories on rationalism and existentialism where Aristotle’s ethical systems give importance on the individual to question his own existence and surroundings in order to know, contrary to a sensual perception of the world. It is important for an individual to know a middle-ground between excess and deficient moral attitudes and characters in order to fully realize the illusions brought about by materialistic objects. Wilful ignorance poses a problem on the understanding of true knowledge since there is no courage to face new objects or truths. Both philosophers mention a certain level of difficulty in attaining virtue or intellectual illumination. It is then necessitated in the individual to fulfil such roles and break away from the ignorant perception of illusionary objects and to find a greater purpose in life. These finite states of worldly objects always posses a cycle of unending pain and only through a mediated understanding of happiness is when man can break away from such trivial cycle and achieve a complete state of understanding. How to cite Aristotle’s Virtuous response to Plato’s Theory of Forms, Papers

John Donne (1236 words) Essay Example For Students

John Donne (1236 words) Essay John DonnePurify my heart for I have sinned: An Irony In John Donnes Batter myheart, three-personed God; for You, the moral and religious qualms of thespeaker are manifest in a sonnet which seems at first almost like an avowalbetween lovers. These convictions of guilt, which stem from his sexual emotion,are what induce desire for a creator/creation relationship with God. Withfurther analysis, the violent and sexual slant on the relationship is alsorevealed. The first expression provides the reader with an initial framework forthe mood of the poem. Donne says, Batter my heart, (1) This opening wordis the first of an upcoming myriad of terms of violence. The impression given isthat the speaker is either a vulnerable and/or masochistic person. However, itbecomes evident in the lines ensueing that the speaker is somewhat disconcerted. Batter my heart, three-personed God; for You As yet but knock, breathe, shine,and seek to mend; That I may rise and stand, oerthrow me, and bend Yourforce, to break, blow, burn, and make me new. (1-4) In lines 1 and 3, he isasking God for torment, to be overcome. In lines 2 and 4, he is requesting to befixed, mended, made new. The speaker is vascillating between the two; he seemsindecisive. The verbs in lines 2 and 4 oddly parallel eachother. They arethematically similar; complementing, but at the same time contradicting. Knockcorresponds to break, as breathe does to blow, and soon. Nonetheless these lines allude to the subordinate role that he takes. Inline 5, a complication emerges. He is to another due. (5) There isanother character in the poem who has seized him by force, like an usurpedtown. (5) In the appropriation of a town, the usurper must be the new rulerof the town, the authoritative leader who snatches the reins of power from theoriginal leader. This image of an usurped t own makes an interestingmetaphor for Satans heist of a mans soul from God. It is the Christianbelief that the human spirit, originally owned by God, is at a constant battlewith the devil, who in turn provides perpetual temptation to which theChristians fall, and want God to mitigate. The speaker says, Labor to admitYou, but Oh, to no end! (6) He desires and works to admit God as thebeholder, the controller and owner of his spirit, but the Devils seizure isto no end. His defense of the viceroy in him proves weak anduntrue. (8) A town is also not quite as unyielding as it appears from theoutside. We saw from line 1 that the speaker wants to be taken by God. Since heis betrothed unto Gods enemy, he needs for God to break his tie toSatan, and to imprison him so that he would unsusceptible to the Devilsdomination. Like someone snared in a defective marriage, he must be divorcedor untied from the knot. The manner in which Donne describes thisdepicts the violent nature of how he wants God to rescue him. He says, Takeme to You, imprison me. (12) It is also obvious in his use of harsh verbs-batter, knock, oerthrow, break, blow, burn, usurp, break, imprison. It seemsto me that the speaker is so keenly aware of his sins and shortcomings that itis imperative that God not only saves him from his sinful ways, but does so inan intense, brutal manner. It is a role which he wants God to play because hefeels the need to be rebuked in two divergent respects; that of the creator andof the restorer. These particular yearnings of treatment demonstate the elevatedfervor and passion of his religious conviction, which in this case isaccompanied by brutality to recompensate his sins. This passion is implicatedwith a sexual character. Batter my heart. (1) In laymans terms itwould say hurt me. Interestingly, the word heart during Donnesera had a sexual connotation. (A Dictionary of Shakespeares Sexual Puns andtheir Significance) This definition does not actually come into play until thec oncluding lines, where he speaks of being raped by God. Except You enthrallme, never shall be free,/ Nor ever chaste, except You ravish me. (13-14)Donnes choice of words is imperative in ascertaining the sexuality of thepoem. The word enthrall means to captivate, charm, and hold in slavery. .u1968253c15ae77c715f901ed68ab9c6e , .u1968253c15ae77c715f901ed68ab9c6e .postImageUrl , .u1968253c15ae77c715f901ed68ab9c6e .centered-text-area { min-height: 80px; position: relative; } .u1968253c15ae77c715f901ed68ab9c6e , .u1968253c15ae77c715f901ed68ab9c6e:hover , .u1968253c15ae77c715f901ed68ab9c6e:visited , .u1968253c15ae77c715f901ed68ab9c6e:active { border:0!important; } .u1968253c15ae77c715f901ed68ab9c6e .clearfix:after { content: ""; display: table; clear: both; } .u1968253c15ae77c715f901ed68ab9c6e { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u1968253c15ae77c715f901ed68ab9c6e:active , .u1968253c15ae77c715f901ed68ab9c6e:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u1968253c15ae77c715f901ed68ab9c6e .centered-text-area { width: 100%; position: relative ; } .u1968253c15ae77c715f901ed68ab9c6e .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u1968253c15ae77c715f901ed68ab9c6e .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u1968253c15ae77c715f901ed68ab9c6e .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u1968253c15ae77c715f901ed68ab9c6e:hover .ctaButton { background-color: #34495E!important; } .u1968253c15ae77c715f901ed68ab9c6e .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u1968253c15ae77c715f901ed68ab9c6e .u1968253c15ae77c715f901ed68ab9c6e-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u1968253c15ae77c715f901ed68ab9c6e:after { content: ""; display: block; clear: both; } READ: Entering The Post-modern Era EssayThe previous and following phrases, imprison me, and never shall befree, (13) indicate that Donne used the word in every meaning. This has botha violent and a sexual slant; he is enslaved forcefully and sexually. Thisforeshadows the fornication which will take place in the next line. Ravishis a key verb, holding significant meaning. It first seems a mere reference tothe act of transporting with strong emotion (esp. joy). However, upon closerinspection, the multiple meanings of the word create an entirely new perspectiveon the poem. The other meanings of ravish are to seize and carry off byforce, to kidnap, to rape and violate, and in Shake spearian times, to rob,plunder. Donne desired for God to seize him from the usurper, the Devilhimself. The aforementioned word chaste, meaning virginal and celibate,bestows coherance on the definition as rape. Referring back to the opening lineof the poem, the usage of the word heart as a sexual reference now makessense. Perhaps it also signifies the vagina; connecting the battering ofa heart to a beating of the vagina, to rape. He is asking God to breakhim (rape him), to make him new. In the concluding line, the speakerstates that he will ever be chaste, except You ravish me. Takenliterally, the phrase contradicts itself. How does one claim that he will neverbe virginal, unless he has been raped? It is apparent here that Donne sees arape from God as purification, a rebirth of virginity; once again, givingemphasis to his need to be punished for his transgressions. This brings intoquestion the exact nature of Donne s relationship with God, and how and whyhe is so spiritually dependen t on God. It is almost curious that God seems to beplaying all of these differing roles. Donne wants God to be the three-personedGod, (1) playing three different roles, the creator/destroyer,restorer/purifier, and raper. The speaker is asking God to purify him, to helphim escape Satans grasp, but at the same time he wants to be raped. He wantsto be recreated, made new, but at the same time mended,rectified in morals. The whole intent of the poem seems contradictory, but it isvery telling of the speakers religious standing. Donne sees rape as a sortof purification of the soul. It sanctifies chastity rather thanannihilating it. He requests this violence to cleanse him of his sinfuldefilements. He wants God to beat the sin out of him because he is tempted byit. His soul is married to the temptation of the world, to the devil and sin. Hence, needs God to imprison him because he feels helpless, aimless; he needsdirection. However he cannot see himself free from sins deathly grip. Thisexplains the irony of the concluding lines. The entire poem is filled withirony, and fittingly, the poem ends in a contradiction. Analogous to the ironyof rape as a means of purification, God builds up as he tears down. Donnesreligious principle is revealed in this metaphor, in his shocking request to beravished into chastity. He is a man who is in desperate need of being forgivenand purified by God, a man who sees violence as the only effective means ofdoing so.

How to Make Swot Analysis free essay sample

Definition SWOT is the acronym for Strengths, Weaknesses, Opportunities and Threats. It is an analytical framework to help summarize in a quick and concise way the risk and opportunities for any company across the value chain. A good SWOT should look into internal and external factors affecting the issue at hand. Factors pertaining to the internal environment of the company. These are usually classified as Strengths (S) or Weaknesses (W) Factors that are external to the company. These are classified as Opportunities (O) or Threats (T).A SWOT analysis helps you match your company’s resources and capabilities to threats and opportunities in the competitive environment. SWOT analysis can be very subjective, but adding weighting and criteria to each factor increases the validity of the analysis. Finally, a SWOT (or TOWS)matrix can help pick the best strategy to implement and takes the SWOT analysis to the next step. See our SWOT matrix below . We will write a custom essay sample on How to Make Swot Analysis? or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Structure of a SWOT analysis A SWOT analysis is typically represented by a 4-box model that lists the Strengths, Weaknesses, Opportunities, and Threats in the following order: StrengthsWeaknessesOpportunitiesThreats As you can see the beauty of a SWOT framework lies in its simplicity. Why use a SWOT analysis? Methodically and honestly assessing your company’s strengths and weaknesses as well as the opportunities and threats it faces gives you a rare opportunity for objective analysis. A SWOT: Is easy to use Combines quantitative and qualitative analysis Encourages interdepartmental collaboration To make sure your analysis is put to good use, include these before and after steps in your analysis process: Set an objective for the analysisSet aside adequate time for research and information-gathering Evaluate the results of your analysis against your original objective This competitive analysis tool guides you through the SWOT technique and will help you create your own analysis that can help you set a strategic plan or present new ideas to your team. Conducting a SWOT analysis There are eight steps required to complete a SWOT analysis and create a SWOT matrix (also known as a TOWS matrix). List external opportunities List external threats List internal strengths List internal weaknessesAt this point in the process, you’ll have a significant list of potential strategies. You’ll need to weigh the impact of the various factors in your analysis and select the most feasible strategy to implement. Ideally, you’ll select a SO strategy, but often you’ll need to implement one of the other three types of strategies to overcome a weakness or address a threat before being in a position to implement a S-O strategy. Questions that a SWOT Analysis Should Answer Here are some questions to help you understand the type of concepts a SWOT should be able to answer.This is list is by no means exhaustive, but will hopefully provide you with some guidance in your endeavors. Strenghts Advantages of proposition? Capabilities? Competitive advantages? USPs (unique selling points)? Resources, Assets, People? Experience, knowledge, data? Financial reserves, likely returns? Marketing reach, distribution, awareness? Innovative aspects? Location and geographical? Price, value, quality? Accreditations, qualifications, certifications? Processes, systems, IT, communications? Cultural, attitudinal, behavioural?Management cover, succession? Philosophy and values? Weaknesses Disadvantages of proposition? Gaps in capabilities? Lack of competitive strength? Reputation, presence and reach? Financials? Own known vulnerabilities? Timescales, deadlines and pressures? Cashflow, start-up cash-drain? Continuity, supply chain robustness? Effects on core activities, distraction? Reliability of data, plan predictability? Morale, commitment, leadership? Accreditations, etc? Processes and systems, etc? Management cover, succession? Opportunities Market developments?Competitors vu lnerabilities? Industry or lifestyle trends? Technology development and innovation? Global influences? New markets, vertical, horizontal? Niche target markets? Geographical, export, import? Tactics: eg, surprise, major contracts? Business and product development? Information and research? Partnerships, agencies, distribution? Volumes, production, economies? Seasonal, weather, fashion influences? Threats Political effects? Legislative effects? Environmental effects? IT developments? Competitor intentions various? Market demand?New technologies, services, ideas? Vital contracts and partners? Sustaining internal capabilities? Obstacles faced? Insurmountable weaknesses? Loss of key staff? Sustainable financial backing? Economy home, abroad? Seasonality, weather effects? The SWOT/TOWS Matrix To develop strategies that take into account the SWOT profile, a matrix of these factors can be constructed. The SWOT matrix (also known as a TOWS matrix by re-arranging the SWOT letters) is shown below: External Opportunities (O) List 4-5 external opportunities here 1. 3. 2. 4. External Threats (T)List 4-5 external threats here 1. 3. 2. 4. Internal Strengths (S) List 4-5 internal threats here 1. 3. 2. 4. S-O Max-Max Strategy Strategies that use strengths to maximize opportunities. S-T Max-Min Strategy Strategies that use strengths to minimize threats. Internal Weaknesses (W) List 4-5 internal weaknesses here 1. 3. 2. 4. W-O Min-Max Strategy Strategies that minimize weaknesses by taking advantage of opportunities. W-T Min-Min Strategy Strategies that minimize weaknesses and avoid threats. Effectively, you have to match each component with one another.For example, match the internal strengths with external opportunities and list the resulting Strengths/Opportunities strategies in the matrix chart The four strategy types are: S-O strategies pursue opportunities that match the company’s strengths. These are the best strategies to employ, but many firms are not in a position to do so. Companies will generally pursue one or several of the other three strategies first to be able to apply Strenghts-Opportunities strategies. W-O strategies overcome weaknesses to pursue opportunities.Your job is to match internal weaknesses with external opportunities and list the resulting Weaknesses-Opportunities strategies S-T strategies identify ways that the firm can use its strengths to reduce its vulnerability to external threats. Your job is to match internal strengths with external threats and list the resulting Strengths-Threats Strategies W-T strategies establish a defe nsive plan to prevent the firm’s weaknesses from making it susceptible to external threats. Your job is to match the internal weaknesses with external threats and record the resulting.

This essay is about Admiral Fisher from ww1. We had to write a biography on an influencial figure from that time

This essay is about Admiral Fisher from ww1. We had to write a biography on an influencial figure from that time Admiral Fisher1841-1920Fisher entered the Navy at age of 13. He was a Midshipman in the Crimean War and in China which was 1859-60, where he took part in the capture of Canton. He was promoted to Captain in 1874 and he commanded various ships. During the bombardment of Alexandria 1882 he was a key part of it as Commander of the battleship Inflexible.He held the post of Director of Naval Ordinance and Torpedoes for five years and was appointed to the Admiralty board as Third Sea Lord and Controller of the navy in 1892 where he was responsible for the material efficiency of the fleet. He was knighted in 1894 and became Second Sea lord in 1902 and finally First Sea Lord in 1904.During his time as First Sea Lord Fisher made changes in the organization of the fleet, the administration of dockyards, ship construction, the development of submarines, the conversion of the navy's ships from the use of coal to that of oil, and weapon development.Lord Fisher and Winston Churchill, First Lord of t...To compete with the rapid growing German Navy he reinforced the British naval forces in home waters and scrapped older obsolete ships which released men to full up ships in reserve.He was also responsible for the creation of the battleship "Dreadnought", the prototype of the all-big-gun ship that revolutionized naval construction and was immediately copied by Germany. When the competition with the German navy became severe Germany built more "Dreadnoughts" than England in one year, he persuaded the British government to begin the construction of eight new battleships. He also created the lightly armoured Invincible-type battle cruisers, which carried heavy armaments but relied on speed for their protection. However in the war these proved to be outclassed by the heavily armoured German battle cruisers.He retired in January...

Criminology & Criminal Justice Essay Example | Topics and Well Written Essays - 1500 words

Criminology & Criminal Justice - Essay Example White citizens receive satisfactory services from police in comparison to other ethnic groups. It was found out that: One of the most controversial areas of police targeting relates to the policing of immigration and the people who are defined as ‘immigrants’. During the 1960s and 1970s ‘coloured immigration’ was not only a potent political issue but also one that framed black and Asian people’s experiences of policing. Many research studies uncovered evidence that ordinary policing often involved checking immigration status (asking, for instance, for passports) when people from ethnic minorities reported crimes of which they had been the victim (Newburn 2007) The criminal justice system should be the epitome of fairness and equity. Police should be fair and just in the execution of their mandate. In the United Kingdom, there have been cases of unfair policing especially towards the ethnic minorities such as blacks. Newburn (200) indicated that sometimes â€Å"a black person reporting a crime is first subject to a background check†. This should not happen since profiling of citizens based on their background is unconstitutional. Public policing should be reformed to ensure that the police do not discriminate citizens based on their ethnic background. The police should be trained to serve citizens equally irrespective of where they come from. Also, any police officer who engages in ethnic profiling should be punished and held criminally liable. The Chicago School proposes that socialization is a core factor in the evaluation of criminal activity in the society. Unlike other theories that focused on an individual’s characteristics to explain crime, the Chicago School postulates that the environment influences people. In essence, there are no people who are born as good or bad. Rather, the external influences of people and social situations play an important role in determining the behavior of a person. The

Cases Essay Example | Topics and Well Written Essays - 1750 words

Cases - Essay Example Teleconferences are held for teaching the staff that facilitates the employees to increase their selling activities. E Bay shares a massive data of suppliers and customers on the site globally. As the information technology industry tends to modify itself due to technological developments, e Bay has successfully coped up by integrating technological advances. The differentiation factor is made necessary to put up a massive potential as it contains research and development. In order to cope up with the future development of e Bay’s strategic capabilities, the development of standards, software and protocols is required. Moreover, the development of strategic alliance is also essential. E-bay must dominate the technological advances and maintain current competencies as well as construct new ones. The hiring procedure must train and grant rewards for the best staff. 2 Case 2 The western countries associated with the beer brewing industry are languishing as compared to the East, w here the brewing industry is rapidly increasing. As Europe has the largest demand for the brewing industry as well as figures of largest beer consumption per person. The figures for global beer production for the market are approx 2.5 million tons per year. As the beer industry and wine industry is increasing its revenues, the spirit industry is dilapidated. From the year 1993 to 1999, the figures for beer production has raised by 12 %. Moreover, the high beer consumption countries in Europe are Czechoslovakia, Ireland and Germany. However, there is a trend for developing flavored beers. These flavored drinks are popular among the teenage group as they consume flavored alcoholic soft drinks. Moreover, trends in the context of environmental issues consist of government involvement for beers come in bottles as government charge for cans. Furthermore, government is also trying to eliminate underage drinking that may cause violence. In addition, there are trends in terms of mergers of c orporate organizations. For instance, GroIsh, Heineken, Interbrew, Scottish and Newcastle Interbrew should launch product development because the people are becoming more health conscious. A product launch named as a ‘low calorie beer’ will be a good option for the consumers. Heineken can expand the variety of flavored beers and low calorie beers in order to compete in an international market. They can gain the attention of young generations by merging with Pepsi or coca cola. In this way, both companies can boost their sales, as the strength of purchasing power will make an impact on a single brand with two manufacturers. Heineken can also participate in sports events by sponsoring athletes to gain exposure to the public. GroIsh have to advance their manufacturing process and equipments. Moreover, they must stop the methods for outsourcing in order to eliminate cost to improve the distribution and transportation processes. Scottish and Newcastle mush emphasize to deliv er improved quality on the brand along with the inclusion of ingredients and advantages. They can spend on research and development for distribution and technology. 3 Case 3 The Virgin group is constructed on various mixtures of businesses. It has involved itself in every business i.e. around 00 businesses. The founder of Virgin was Sir Richard Branson who started it in 1970. The Virgin brand name was considered as the most essential

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

Economic growth and economic development Essay

Like the infrastructure development, improvement of legal mechanism Can now be regarded as the most important precondition for sustainable Growth, a stronger economy, and pro-people system of governance, Writes M S Siddiqui Economic development generally refers to sustained and concerted actions, taken by the policy-makers and communities, which promote the standard of living and economic health of a specific area. Economic development can also refer to as being quantitative and qualitative changes in the economy. Such actions might involve multiple areas including development of human capital, critical infrastructure, regional competitiveness, environmental sustainability, social inclusion, health, safety, literacy, and other initiatives. Economic development differs from economic growth. Whereas economic development is a policy intervention endeavour with aims of economic and social well-being of the people, economic growth is a phenomenon of market productivity and rise in GDP (gross domestic product). According to Amartya Sen, â€Å"economic growth is one aspect of the process of economic development.† Despite the good performance of Bangladesh in terms of many growth indices, it has been lagging behind in building a necessary infrastructure for achieving goals for the country to be treated as a middle-income one. Economic governance embraces all macroeconomic, microeconomic and fiscal policies, public economic agencies, regulatory bodies, company laws and legal institutions connected with economic matters. Good governance means an efficient, open, accountable and audited public service, which has the bureaucratic competence to help design and implement appropriate public policies and, at the same time, an independent judicial system to uphold the law. Good governance is a system of governance that is able to unambiguously identify the basic values of society, where values are economic, political and socio-cultural issues including human rights, and pursue these values through an accountable and honest administration. It is obvious that good governance is a must for the development and growth of a nation. Good governance generally implies a number of institutions, which regulate the behaviour of public bodies, stimulate citizens’ participation in government and control public-private relations. Governance is government plus the private and third (not for profit) sectors. In the 1992 report titled â€Å"Governance and Development†, the World Bank gave its definition of good governance. Good governance is defined as â€Å"the manner in which power is exercised in the management of a country’s economic and social resources for development†. In an October 1995 policy paper called â€Å"Governance: Sound Development Management†, the ADB outlined its policy on this topic. Further, in a separate opinion issued by the ADB General Council, it was explained that governance has at least two dimensions: (a) political (e.g., democracy, human rights); and (b) economic (e.g., efficient management of public resources). The United Nations Development Programme’s (UNDP) definition of good governance is spelled out in a 1997 UNDP policy document titled â€Å"Governance for Sustainable Human Development†. The document states that governance can be seen as the exercise of economic, political and administrative authority to manage a country’s affairs at all levels. The key elements of good governance as defined by UNDP are listed below: Participation: Participation by both men and women is a key cornerstone of good governance. All men and women should have a voice in decision making either directly or through legitimate intermediate institutions that represent their interests. Rule of law: Legal frameworks should be fair and enforced impartially, particularly the laws on human rights. Transparency: Transparency is built on the free flow of information. Processes, institutions and information are directly accessible to those concerned through it, and enough information is provided to understand and monitor them. Responsiveness: Good governance requires that institutions and processes try to serve all stakeholders within a reasonable timeframe. Consensus orientation: There are several actors and as many viewpoints in a given society. Good governance requires mediation of different interests in society to reach a broad consensus on what is in the best interest of the whole community and how this can be achieved. Equity: All men and women have opportunities to improve or maintain their well-being. Effectiveness and efficiency: Good governance means that processes and institutions produce results that meet the needs of society, while making the best use of resources at their disposal. Strategic vision: Leaders and the public have a broad and long-term perspective on good governance and human development, along with a sense of what is needed for such development. There is also an understanding of the historical, cultural and social complexities, in which that perspective is grounded. The rule of law as gauged by the responses to ‘efficient functioning of judiciary’ indicates that most low and middle-income countries rate it as a much higher obstacle than their high-income counterparts. The aggregate average of street crime, organised crime, and corruption are all higher in these countries than in the developed world. There are many problems that come up as barriers to good governance. To ensure sound local development, action should be taken to work towards achieving good governance. The legal policy regime of a country provides base to the potential Foreign Direct Investment (FDI). Unequivocal, neutral legal framework and better protection of property rights can lead to higher FDI. The legal and regulatory environment does matter for financial development. Countries with legal and regulatory systems that give a high priority to creditors receive the full value of their claims on cooperation, have better- functioning financial intermediaries than countries where the legal system provides much weaker support to creditors. Bangladesh is the seventh largest country in the world in terms of its population and now it is treated as ‘N-11’ after the BRICS countries. However, without progress in legal arenas, such as making suitable laws and their appropriate execution, speedy resolution of all corporate and financial disputes, and quick and transparent transfer of properties, some vital sectors of Bangladeshi economy may suffer irreparable loses. Like the infrastructural development, improvement of legal mechanism can now be regarded as the most important precondition for sustainable growth, a stronger economy, and pro-people system of governance. The writer is pursuing PhD at the Open University, Malaysia. shah@banglachemical.com

Aegean, Roman, and Greek Cultures Essay

Aegean civilization flourished during the Bronze Age in Greece and the so-called Aegean Age. Minoan and Mycenaean civilizations were among those civilizations in the Aegean that has made its zenith during this era. Minoan civilization developed on the mountainous areas of Crete. Crete naturally possessed a wide-range of harbors which made it possible for the Minoans to settle and establish permanent livelihood as traders and merchants. From 1700 BC, they were involved in various trades including the important tin trading that is used to make bronze. Minoans focused their belief on female deities (note that Minoan women were usually appointed officials – a symbol of respect and authority). Many archeologists believed that the Minoans have equal treatment to men and women. Evidences from Minoan artworks showed that the equal status of men and women. Minoan artworks also showed evidences of the development of the Minoan civilization (three periods of Minoan civilization – EM, MM, and LM). Among the surviving Minoan arts is Minoan pottery. Different periods of Minoan civilization also showed different modes of design of their ceramics which include spirals in the Early Minoan, natural designs like flowers and birds during the Middle Minoan. After the demise of the Aegean civilization (during the Hittite invasion of Asia Minor), Greece began to make advances in culture. The development of the city-state allowed the propagation of culture across geography – enabling city-states to develop its own cultural tools. It can be said that the zenith of Greek culture was during the Hellenistic period (lasted for about 200 years). The Greek Hellenistic period span from 323 B. C. up to the Battle of Actium in 31 B. C. The Hellenistic period paved the way to many transformations of Greek art. Though the Classical concepts in art were not thoroughly abandoned, the birth of the Hellenistic period made the artists create different and unique art concepts. The artists during this time explored and manipulated their imagination on their subject. It was also during this period that higher degree of Naturalism took place as a logical conclusion to great sculptors like Praxitelis and Lysipos whose works demanded for the art representation of the human figure. In a Greek art (Boy Jockey), the bold expression of energy and power during great pressure was represented. The change of focus of the Hellenistic art from religious and naturalistic ideas and concepts to human expressions, psychological concern and theatrical background, paved the way to the sculptures that includes the natural physical surroundings with creative landscaping and theatrical groupings. The Nike of Samothrace is a sculpture that embraced the true meaning and understood the world through the application of certain techniques and aesthetic conventions. The winged goddess with her outstretched wings gracefully prevents the stone from falling due to gravity. The sculpture also represented the physical human presence and the external force within it. The representation evidently speaks for the Greeks acceptance of the physical power of human being and all other external forces acting on it. Elsewhere in the Mediterranean Sea, a new power was on the rise. Roman expansion to the East resulted to: 1) consolidation of the Greek peninsula under Roman rule; 2) the destruction of Macedonia, weakening of the Seleucid Empire, and the incorporation of the states of Bithynia and Pergamum to Rome; and 3) increased Greek influence on Roman culture. Although Roman art is essentially a derivation of Greek art, it is different in two respects. First, Roman art is generally a modification of Greek art. The invention of concrete during the 1st century A. D. greatly advanced Roman art and architecture. For example, the simple amphitheatre of the Greeks was transformed into a colosseum. Concrete allowed the construction of more complex structures. Second, Greek art was essentially religious in character (this is assertion is debatable for some historians). Roman art and architecture was a mixture of religious and political philosophies. The Roman poet Ovid often referred to the Greeks as the champion of religious authority – the center of religious worship in the Mediterranean Sea, and the Romans as the bearer of Greek culture. Here, Ovid was essentially arguing that Roman culture cannot be solely religious in nature. As the forerunner of ancient democratic institutions, Rome must distinguish itself politically from its subject peoples. With Roman domination of the Mediterranean, Greek culture spread to all parts of the Roman Empire. In the East, it became the ethos of a new cultural revival – Greek in orientation. This revival was essentially the last if not the least of Hellenism prior to the rise of Christianity as the dominant religion in the Roman Empire. Before the Christian culture, Greek culture was the predominant mode of humanistic endeavor. However, one must understand that Greek culture was a partial derivation of Aegean culture – a culture which is embellished in myth, tragedy, and greatness. Here, one can clearly see the development of Western culture – a result of the transfusion of Greek culture and Christian learning.