Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

Economic growth and economic development Essay

Like the infrastructure development, improvement of legal mechanism Can now be regarded as the most important precondition for sustainable Growth, a stronger economy, and pro-people system of governance, Writes M S Siddiqui Economic development generally refers to sustained and concerted actions, taken by the policy-makers and communities, which promote the standard of living and economic health of a specific area. Economic development can also refer to as being quantitative and qualitative changes in the economy. Such actions might involve multiple areas including development of human capital, critical infrastructure, regional competitiveness, environmental sustainability, social inclusion, health, safety, literacy, and other initiatives. Economic development differs from economic growth. Whereas economic development is a policy intervention endeavour with aims of economic and social well-being of the people, economic growth is a phenomenon of market productivity and rise in GDP (gross domestic product). According to Amartya Sen, â€Å"economic growth is one aspect of the process of economic development.† Despite the good performance of Bangladesh in terms of many growth indices, it has been lagging behind in building a necessary infrastructure for achieving goals for the country to be treated as a middle-income one. Economic governance embraces all macroeconomic, microeconomic and fiscal policies, public economic agencies, regulatory bodies, company laws and legal institutions connected with economic matters. Good governance means an efficient, open, accountable and audited public service, which has the bureaucratic competence to help design and implement appropriate public policies and, at the same time, an independent judicial system to uphold the law. Good governance is a system of governance that is able to unambiguously identify the basic values of society, where values are economic, political and socio-cultural issues including human rights, and pursue these values through an accountable and honest administration. It is obvious that good governance is a must for the development and growth of a nation. Good governance generally implies a number of institutions, which regulate the behaviour of public bodies, stimulate citizens’ participation in government and control public-private relations. Governance is government plus the private and third (not for profit) sectors. In the 1992 report titled â€Å"Governance and Development†, the World Bank gave its definition of good governance. Good governance is defined as â€Å"the manner in which power is exercised in the management of a country’s economic and social resources for development†. In an October 1995 policy paper called â€Å"Governance: Sound Development Management†, the ADB outlined its policy on this topic. Further, in a separate opinion issued by the ADB General Council, it was explained that governance has at least two dimensions: (a) political (e.g., democracy, human rights); and (b) economic (e.g., efficient management of public resources). The United Nations Development Programme’s (UNDP) definition of good governance is spelled out in a 1997 UNDP policy document titled â€Å"Governance for Sustainable Human Development†. The document states that governance can be seen as the exercise of economic, political and administrative authority to manage a country’s affairs at all levels. The key elements of good governance as defined by UNDP are listed below: Participation: Participation by both men and women is a key cornerstone of good governance. All men and women should have a voice in decision making either directly or through legitimate intermediate institutions that represent their interests. Rule of law: Legal frameworks should be fair and enforced impartially, particularly the laws on human rights. Transparency: Transparency is built on the free flow of information. Processes, institutions and information are directly accessible to those concerned through it, and enough information is provided to understand and monitor them. Responsiveness: Good governance requires that institutions and processes try to serve all stakeholders within a reasonable timeframe. Consensus orientation: There are several actors and as many viewpoints in a given society. Good governance requires mediation of different interests in society to reach a broad consensus on what is in the best interest of the whole community and how this can be achieved. Equity: All men and women have opportunities to improve or maintain their well-being. Effectiveness and efficiency: Good governance means that processes and institutions produce results that meet the needs of society, while making the best use of resources at their disposal. Strategic vision: Leaders and the public have a broad and long-term perspective on good governance and human development, along with a sense of what is needed for such development. There is also an understanding of the historical, cultural and social complexities, in which that perspective is grounded. The rule of law as gauged by the responses to ‘efficient functioning of judiciary’ indicates that most low and middle-income countries rate it as a much higher obstacle than their high-income counterparts. The aggregate average of street crime, organised crime, and corruption are all higher in these countries than in the developed world. There are many problems that come up as barriers to good governance. To ensure sound local development, action should be taken to work towards achieving good governance. The legal policy regime of a country provides base to the potential Foreign Direct Investment (FDI). Unequivocal, neutral legal framework and better protection of property rights can lead to higher FDI. The legal and regulatory environment does matter for financial development. Countries with legal and regulatory systems that give a high priority to creditors receive the full value of their claims on cooperation, have better- functioning financial intermediaries than countries where the legal system provides much weaker support to creditors. Bangladesh is the seventh largest country in the world in terms of its population and now it is treated as ‘N-11’ after the BRICS countries. However, without progress in legal arenas, such as making suitable laws and their appropriate execution, speedy resolution of all corporate and financial disputes, and quick and transparent transfer of properties, some vital sectors of Bangladeshi economy may suffer irreparable loses. Like the infrastructural development, improvement of legal mechanism can now be regarded as the most important precondition for sustainable growth, a stronger economy, and pro-people system of governance. The writer is pursuing PhD at the Open University, Malaysia. shah@banglachemical.com

Aegean, Roman, and Greek Cultures Essay

Aegean civilization flourished during the Bronze Age in Greece and the so-called Aegean Age. Minoan and Mycenaean civilizations were among those civilizations in the Aegean that has made its zenith during this era. Minoan civilization developed on the mountainous areas of Crete. Crete naturally possessed a wide-range of harbors which made it possible for the Minoans to settle and establish permanent livelihood as traders and merchants. From 1700 BC, they were involved in various trades including the important tin trading that is used to make bronze. Minoans focused their belief on female deities (note that Minoan women were usually appointed officials – a symbol of respect and authority). Many archeologists believed that the Minoans have equal treatment to men and women. Evidences from Minoan artworks showed that the equal status of men and women. Minoan artworks also showed evidences of the development of the Minoan civilization (three periods of Minoan civilization – EM, MM, and LM). Among the surviving Minoan arts is Minoan pottery. Different periods of Minoan civilization also showed different modes of design of their ceramics which include spirals in the Early Minoan, natural designs like flowers and birds during the Middle Minoan. After the demise of the Aegean civilization (during the Hittite invasion of Asia Minor), Greece began to make advances in culture. The development of the city-state allowed the propagation of culture across geography – enabling city-states to develop its own cultural tools. It can be said that the zenith of Greek culture was during the Hellenistic period (lasted for about 200 years). The Greek Hellenistic period span from 323 B. C. up to the Battle of Actium in 31 B. C. The Hellenistic period paved the way to many transformations of Greek art. Though the Classical concepts in art were not thoroughly abandoned, the birth of the Hellenistic period made the artists create different and unique art concepts. The artists during this time explored and manipulated their imagination on their subject. It was also during this period that higher degree of Naturalism took place as a logical conclusion to great sculptors like Praxitelis and Lysipos whose works demanded for the art representation of the human figure. In a Greek art (Boy Jockey), the bold expression of energy and power during great pressure was represented. The change of focus of the Hellenistic art from religious and naturalistic ideas and concepts to human expressions, psychological concern and theatrical background, paved the way to the sculptures that includes the natural physical surroundings with creative landscaping and theatrical groupings. The Nike of Samothrace is a sculpture that embraced the true meaning and understood the world through the application of certain techniques and aesthetic conventions. The winged goddess with her outstretched wings gracefully prevents the stone from falling due to gravity. The sculpture also represented the physical human presence and the external force within it. The representation evidently speaks for the Greeks acceptance of the physical power of human being and all other external forces acting on it. Elsewhere in the Mediterranean Sea, a new power was on the rise. Roman expansion to the East resulted to: 1) consolidation of the Greek peninsula under Roman rule; 2) the destruction of Macedonia, weakening of the Seleucid Empire, and the incorporation of the states of Bithynia and Pergamum to Rome; and 3) increased Greek influence on Roman culture. Although Roman art is essentially a derivation of Greek art, it is different in two respects. First, Roman art is generally a modification of Greek art. The invention of concrete during the 1st century A. D. greatly advanced Roman art and architecture. For example, the simple amphitheatre of the Greeks was transformed into a colosseum. Concrete allowed the construction of more complex structures. Second, Greek art was essentially religious in character (this is assertion is debatable for some historians). Roman art and architecture was a mixture of religious and political philosophies. The Roman poet Ovid often referred to the Greeks as the champion of religious authority – the center of religious worship in the Mediterranean Sea, and the Romans as the bearer of Greek culture. Here, Ovid was essentially arguing that Roman culture cannot be solely religious in nature. As the forerunner of ancient democratic institutions, Rome must distinguish itself politically from its subject peoples. With Roman domination of the Mediterranean, Greek culture spread to all parts of the Roman Empire. In the East, it became the ethos of a new cultural revival – Greek in orientation. This revival was essentially the last if not the least of Hellenism prior to the rise of Christianity as the dominant religion in the Roman Empire. Before the Christian culture, Greek culture was the predominant mode of humanistic endeavor. However, one must understand that Greek culture was a partial derivation of Aegean culture – a culture which is embellished in myth, tragedy, and greatness. Here, one can clearly see the development of Western culture – a result of the transfusion of Greek culture and Christian learning.

Gender Orientation And Sexual Orientation - 1613 Words

Did you know that gay men and lesbians do not choose their sexual orientation, but rather are born with it? There has been extensive research proving that sexual orientation is caused by many biological factors, whereas there is no solid proof that social factors after birth affect sexual orientation (Swaab, 2007, p. 442). Sexual orientation is already programmed into the brain, with the influence of sex hormones and genes, before a child is even born. The development of sexual orientation is caused by sex hormones, genes, and the brain, which then cause differences in the anatomical body (LeVay, 2011, p.271). Firstly, sex hormones that mainly influence a person’s sexual orientation are the levels of testosterone during critical periods of prenatal development (LeVay, 2011, p. 132). If androgen insensitivity syndrome occurs in individuals with XY chromosomes, the gene coding for the androgen receptor is mutated, causing the receptor to either barely function, or not at all (Le Vay, 2011, p. 137). This causes their body to not respond to testosterone, so they begin to develop physically as a female. From here on, they are usually raised as girls, and they develop an attraction to males, as well a feminine-typical traits. A condition that can occur in females is called Congenital Adrenal Hyperplasia, which is when there are above normal amounts of prenatal testosterone and androgens, which causes a female to grow up with masculinized traits (LeVay, 2011, p. 134). A majorityShow MoreRelatedSexual Orientation And Gender Orientation Essay903 Words   |  4 Pagese Henry Paper 4 Sexual orientation The theme that we have been focusing on in class for the past two weeks is sexual orientation. Sexual orientation is more complex than just the gender a person is attracted to. Instead sexual orientation is on more of a spectrum. On one end of the spectrum a person can be solely heterosexual and on the opposite side a person can be completely homosexual. This also means that a person can be bisexual if they identify more in the middle of the spectrum. TheRead MoreGender Orientation And Sexual Orientation Essay1849 Words   |  8 PagesGender and sexual orientation is a topic that has been and still today is not talked about in such a way it should be because of how society has chosen to structure and control it. Social stratification is a system in which groups of people are divided up into layers according to their relative privileges (power, property, and prestige). It’s a way of ranking large groups of people into a hierarchy according to their relative privileges (Vela-Mc Connell 2016). People, who deviate from the norm ofRead MoreGender, Gender And Sexual Orientation Essay2043 Words   |  9 Pageshas been passed to rectify past oppression of racial, gender and sexual orientation groups, America remains a patriarchal society whose institutions are structurally designed to favor white, cisgender, heterosexual males. The film Higher Learning, brings to light this issue of institutional racism, while perpetuating in majority of the male characters what the ideal man represents and how that is related to racial issues and sexual orientation in the film. Issues of homosexuality is not only broughtRead MoreThe Sexual Orientation And Gender1455 Words   |  6 Pages The two individuals I interviewed are homosexual males that differ from me in their sexual orientation and gender. I met my first interviewee for an hour on Wednesday, September 21st, and I met my second interviewee for an hour on Wednesday, September 28th. Through these interviews, I learned a great deal about each individual and it allowed me to gain insight into each of their lives. The first individual I interviewed is named Brandon and lives in Lebanon, Missouri. He was born in Osage BeachRead MoreSexual Orientation Is The Dominant, Or Normal, Sexual, And Gender Orientation Essay2260 Words   |  10 PagesIntroduction Sexual orientationism is best described as discrimination or prejudice against homosexuals on the assumption that heterosexuality is the dominant, or normal, sexual orientation. Within society there are many barriers, assumptions, and stigmas placed upon the queer community, numerous of which steam from this heterosexist stance that has become the dominant ideology. This stance has historical significance in trauma, and oppression of those within the sexual minority, and how this canRead MoreSexual Orientation : Sex And Gender1783 Words   |  8 PagesToday I will be weighing in on the essentialism vs constructioni^^^sm debate on sexual orientation. Before I proceed further I must define sexual orientation which in turn needs me to define sex and gender. What is sexual orientation? There is the behavioral where one’s sexual orientation is defined by the sex of the person that he or she has sex with. If one has sex with a person of the same sex then they are homosexual and if they have sex with someone from the different sex then they are heterosexualRead MoreGender, Sexual Orientation And Education1746 Words   |  7 PagesIn today’s society, there are divides that impede the movement of progress. These divides may disperse around a number of issues that revolve around gender, religion, sexual orientation and education. These divides have created an un-opened minded society that judge people and groups based on the prejudices and stereotypes that treat them differently. In the aspect of identity discrimination, American society plays a big role in keeping those that are different isolated from the rest of the worldRead MoreGender And Sexual Orientation Of Diversity1582 Words   |  7 Pagestourism and hospitality industry. At present the gender and sexual orientation not only are held hostage-cutting in various parts of the world changes in the process, but also by the transformation of society throughout the thousand-state changes. They put gender as a key variable, focusing inspected it with other social differences cross interaction. In their view, all grades are interrelated, gender, race, ethnicity, national, class, sexual orientation, age, geographical, and many of the differencesRead MoreSexual Orientation And Gender Identity2164 Words   |  9 Pages As mainstream media is now embracing the once taboo topics of sexual orientation and gender identity as popular culture utilities, psychologists and medical professionals are still researching the biological, psychological, and social differences between the two. Since the phenomena of  ¨coming out, or openly identifying as a sexual orientation or gender identity besides heterosexual or cisgender respectively, is a relatively recent anomaly, there is limited but contemporary research. The analysesRead MoreSexual Orientation And Gender Identity863 Words   |  4 PagesRecent studies estimate that between one and nine million children in the United States have at least one parent who is either lesbian, gay, or transgender. However, many people feel uncomfortable about being open due to their sexual orientation and gender identity due to fears of discrimination; such fears include, but are not limited to, loss of employment, loss of child custody, anti-gay violence and hate crimes. Although many people may have distinctive opinions on certain outcomes or effects