Monday, March 30, 2020
How to Make Swot Analysis free essay sample
Definition SWOT is the acronym for Strengths, Weaknesses, Opportunities and Threats. It is an analytical framework to help summarize in a quick and concise way the risk and opportunities for any company across the value chain. A good SWOT should look into internal and external factors affecting the issue at hand. Factors pertaining to the internal environment of the company. These are usually classified as Strengths (S) or Weaknesses (W) Factors that are external to the company. These are classified as Opportunities (O) or Threats (T).A SWOT analysis helps you match your companyââ¬â¢s resources and capabilities to threats and opportunities in the competitive environment. SWOT analysis can be very subjective, but adding weighting and criteria to each factor increases the validity of the analysis. Finally, a SWOT (or TOWS)matrix can help pick the best strategy to implement and takes the SWOT analysis to the next step. See our SWOT matrix below . We will write a custom essay sample on How to Make Swot Analysis? or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page Structure of a SWOT analysis A SWOT analysis is typically represented by a 4-box model that lists the Strengths, Weaknesses, Opportunities, and Threats in the following order: StrengthsWeaknessesOpportunitiesThreats As you can see the beauty of a SWOT framework lies in its simplicity. Why use a SWOT analysis? Methodically and honestly assessing your companyââ¬â¢s strengths and weaknesses as well as the opportunities and threats it faces gives you a rare opportunity for objective analysis. A SWOT: Is easy to use Combines quantitative and qualitative analysis Encourages interdepartmental collaboration To make sure your analysis is put to good use, include these before and after steps in your analysis process: Set an objective for the analysisSet aside adequate time for research and information-gathering Evaluate the results of your analysis against your original objective This competitive analysis tool guides you through the SWOT technique and will help you create your own analysis that can help you set a strategic plan or present new ideas to your team. Conducting a SWOT analysis There are eight steps required to complete a SWOT analysis and create a SWOT matrix (also known as a TOWS matrix). List external opportunities List external threats List internal strengths List internal weaknessesAt this point in the process, youââ¬â¢ll have a significant list of potential strategies. Youââ¬â¢ll need to weigh the impact of the various factors in your analysis and select the most feasible strategy to implement. Ideally, youââ¬â¢ll select a SO strategy, but often youââ¬â¢ll need to implement one of the other three types of strategies to overcome a weakness or address a threat before being in a position to implement a S-O strategy. Questions that a SWOT Analysis Should Answer Here are some questions to help you understand the type of concepts a SWOT should be able to answer.This is list is by no means exhaustive, but will hopefully provide you with some guidance in your endeavors. Strenghts Advantages of proposition? Capabilities? Competitive advantages? USPs (unique selling points)? Resources, Assets, People? Experience, knowledge, data? Financial reserves, likely returns? Marketing reach, distribution, awareness? Innovative aspects? Location and geographical? Price, value, quality? Accreditations, qualifications, certifications? Processes, systems, IT, communications? Cultural, attitudinal, behavioural?Management cover, succession? Philosophy and values? Weaknesses Disadvantages of proposition? Gaps in capabilities? Lack of competitive strength? Reputation, presence and reach? Financials? Own known vulnerabilities? Timescales, deadlines and pressures? Cashflow, start-up cash-drain? Continuity, supply chain robustness? Effects on core activities, distraction? Reliability of data, plan predictability? Morale, commitment, leadership? Accreditations, etc? Processes and systems, etc? Management cover, succession? Opportunities Market developments?Competitors vu lnerabilities? Industry or lifestyle trends? Technology development and innovation? Global influences? New markets, vertical, horizontal? Niche target markets? Geographical, export, import? Tactics: eg, surprise, major contracts? Business and product development? Information and research? Partnerships, agencies, distribution? Volumes, production, economies? Seasonal, weather, fashion influences? Threats Political effects? Legislative effects? Environmental effects? IT developments? Competitor intentions various? Market demand?New technologies, services, ideas? Vital contracts and partners? Sustaining internal capabilities? Obstacles faced? Insurmountable weaknesses? Loss of key staff? Sustainable financial backing? Economy home, abroad? Seasonality, weather effects? The SWOT/TOWS Matrix To develop strategies that take into account the SWOT profile, a matrix of these factors can be constructed. The SWOT matrix (also known as a TOWS matrix by re-arranging the SWOT letters) is shown below: External Opportunities (O) List 4-5 external opportunities here 1. 3. 2. 4. External Threats (T)List 4-5 external threats here 1. 3. 2. 4. Internal Strengths (S) List 4-5 internal threats here 1. 3. 2. 4. S-O Max-Max Strategy Strategies that use strengths to maximize opportunities. S-T Max-Min Strategy Strategies that use strengths to minimize threats. Internal Weaknesses (W) List 4-5 internal weaknesses here 1. 3. 2. 4. W-O Min-Max Strategy Strategies that minimize weaknesses by taking advantage of opportunities. W-T Min-Min Strategy Strategies that minimize weaknesses and avoid threats. Effectively, you have to match each component with one another.For example, match the internal strengths with external opportunities and list the resulting Strengths/Opportunities strategies in the matrix chart The four strategy types are: S-O strategies pursue opportunities that match the companyââ¬â¢s strengths. These are the best strategies to employ, but many firms are not in a position to do so. Companies will generally pursue one or several of the other three strategies first to be able to apply Strenghts-Opportunities strategies. W-O strategies overcome weaknesses to pursue opportunities.Your job is to match internal weaknesses with external opportunities and list the resulting Weaknesses-Opportunities strategies S-T strategies identify ways that the firm can use its strengths to reduce its vulnerability to external threats. Your job is to match internal strengths with external threats and list the resulting Strengths-Threats Strategies W-T strategies establish a defe nsive plan to prevent the firmââ¬â¢s weaknesses from making it susceptible to external threats. Your job is to match the internal weaknesses with external threats and record the resulting.
Saturday, March 7, 2020
This essay is about Admiral Fisher from ww1. We had to write a biography on an influencial figure from that time
This essay is about Admiral Fisher from ww1. We had to write a biography on an influencial figure from that time Admiral Fisher1841-1920Fisher entered the Navy at age of 13. He was a Midshipman in the Crimean War and in China which was 1859-60, where he took part in the capture of Canton. He was promoted to Captain in 1874 and he commanded various ships. During the bombardment of Alexandria 1882 he was a key part of it as Commander of the battleship Inflexible.He held the post of Director of Naval Ordinance and Torpedoes for five years and was appointed to the Admiralty board as Third Sea Lord and Controller of the navy in 1892 where he was responsible for the material efficiency of the fleet. He was knighted in 1894 and became Second Sea lord in 1902 and finally First Sea Lord in 1904.During his time as First Sea Lord Fisher made changes in the organization of the fleet, the administration of dockyards, ship construction, the development of submarines, the conversion of the navy's ships from the use of coal to that of oil, and weapon development.Lord Fisher and Winston Churchill, First Lord of t...To compete with the rapid growing German Navy he reinforced the British naval forces in home waters and scrapped older obsolete ships which released men to full up ships in reserve.He was also responsible for the creation of the battleship "Dreadnought", the prototype of the all-big-gun ship that revolutionized naval construction and was immediately copied by Germany. When the competition with the German navy became severe Germany built more "Dreadnoughts" than England in one year, he persuaded the British government to begin the construction of eight new battleships. He also created the lightly armoured Invincible-type battle cruisers, which carried heavy armaments but relied on speed for their protection. However in the war these proved to be outclassed by the heavily armoured German battle cruisers.He retired in January...
Thursday, February 20, 2020
Criminology & Criminal Justice Essay Example | Topics and Well Written Essays - 1500 words
Criminology & Criminal Justice - Essay Example White citizens receive satisfactory services from police in comparison to other ethnic groups. It was found out that: One of the most controversial areas of police targeting relates to the policing of immigration and the people who are defined as ââ¬Ëimmigrantsââ¬â¢. During the 1960s and 1970s ââ¬Ëcoloured immigrationââ¬â¢ was not only a potent political issue but also one that framed black and Asian peopleââ¬â¢s experiences of policing. Many research studies uncovered evidence that ordinary policing often involved checking immigration status (asking, for instance, for passports) when people from ethnic minorities reported crimes of which they had been the victim (Newburn 2007) The criminal justice system should be the epitome of fairness and equity. Police should be fair and just in the execution of their mandate. In the United Kingdom, there have been cases of unfair policing especially towards the ethnic minorities such as blacks. Newburn (200) indicated that sometimes ââ¬Å"a black person reporting a crime is first subject to a background checkâ⬠. This should not happen since profiling of citizens based on their background is unconstitutional. Public policing should be reformed to ensure that the police do not discriminate citizens based on their ethnic background. The police should be trained to serve citizens equally irrespective of where they come from. Also, any police officer who engages in ethnic profiling should be punished and held criminally liable. The Chicago School proposes that socialization is a core factor in the evaluation of criminal activity in the society. Unlike other theories that focused on an individualââ¬â¢s characteristics to explain crime, the Chicago School postulates that the environment influences people. In essence, there are no people who are born as good or bad. Rather, the external influences of people and social situations play an important role in determining the behavior of a person. The
Tuesday, February 4, 2020
Cases Essay Example | Topics and Well Written Essays - 1750 words
Cases - Essay Example Teleconferences are held for teaching the staff that facilitates the employees to increase their selling activities. E Bay shares a massive data of suppliers and customers on the site globally. As the information technology industry tends to modify itself due to technological developments, e Bay has successfully coped up by integrating technological advances. The differentiation factor is made necessary to put up a massive potential as it contains research and development. In order to cope up with the future development of e Bayââ¬â¢s strategic capabilities, the development of standards, software and protocols is required. Moreover, the development of strategic alliance is also essential. E-bay must dominate the technological advances and maintain current competencies as well as construct new ones. The hiring procedure must train and grant rewards for the best staff. 2 Case 2 The western countries associated with the beer brewing industry are languishing as compared to the East, w here the brewing industry is rapidly increasing. As Europe has the largest demand for the brewing industry as well as figures of largest beer consumption per person. The figures for global beer production for the market are approx 2.5 million tons per year. As the beer industry and wine industry is increasing its revenues, the spirit industry is dilapidated. From the year 1993 to 1999, the figures for beer production has raised by 12 %. Moreover, the high beer consumption countries in Europe are Czechoslovakia, Ireland and Germany. However, there is a trend for developing flavored beers. These flavored drinks are popular among the teenage group as they consume flavored alcoholic soft drinks. Moreover, trends in the context of environmental issues consist of government involvement for beers come in bottles as government charge for cans. Furthermore, government is also trying to eliminate underage drinking that may cause violence. In addition, there are trends in terms of mergers of c orporate organizations. For instance, GroIsh, Heineken, Interbrew, Scottish and Newcastle Interbrew should launch product development because the people are becoming more health conscious. A product launch named as a ââ¬Ëlow calorie beerââ¬â¢ will be a good option for the consumers. Heineken can expand the variety of flavored beers and low calorie beers in order to compete in an international market. They can gain the attention of young generations by merging with Pepsi or coca cola. In this way, both companies can boost their sales, as the strength of purchasing power will make an impact on a single brand with two manufacturers. Heineken can also participate in sports events by sponsoring athletes to gain exposure to the public. GroIsh have to advance their manufacturing process and equipments. Moreover, they must stop the methods for outsourcing in order to eliminate cost to improve the distribution and transportation processes. Scottish and Newcastle mush emphasize to deliv er improved quality on the brand along with the inclusion of ingredients and advantages. They can spend on research and development for distribution and technology. 3 Case 3 The Virgin group is constructed on various mixtures of businesses. It has involved itself in every business i.e. around 00 businesses. The founder of Virgin was Sir Richard Branson who started it in 1970. The Virgin brand name was considered as the most essential
Monday, January 27, 2020
Heteroplasmy and Response Against Azoxystrobin in Cercospora
Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000 à µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100 à µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01 à µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60 à µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25 à µl consisting of 1.25 à µl (10 à µM) of each primer, 12.5 à µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25 à µl DNA and 8.5 à µl water and run in following settings: initial denaturation at 94à ° C for 2 min followed by 29 cycles of denaturation at 94à ° C for 20 s, annealing at 55à ° C for 25 s, extension at 72à ° C for 1 min and final extension at 72à ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â ¬Ã Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â ¬Ã 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â ¬Ã Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â ¬Ã specific realà ¢Ã¢â ¬Ã time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.
Sunday, January 19, 2020
Economic growth and economic development Essay
Like the infrastructure development, improvement of legal mechanism Can now be regarded as the most important precondition for sustainable Growth, a stronger economy, and pro-people system of governance, Writes M S Siddiqui Economic development generally refers to sustained and concerted actions, taken by the policy-makers and communities, which promote the standard of living and economic health of a specific area. Economic development can also refer to as being quantitative and qualitative changes in the economy. Such actions might involve multiple areas including development of human capital, critical infrastructure, regional competitiveness, environmental sustainability, social inclusion, health, safety, literacy, and other initiatives. Economic development differs from economic growth. Whereas economic development is a policy intervention endeavour with aims of economic and social well-being of the people, economic growth is a phenomenon of market productivity and rise in GDP (gross domestic product). According to Amartya Sen, ââ¬Å"economic growth is one aspect of the process of economic development.â⬠Despite the good performance of Bangladesh in terms of many growth indices, it has been lagging behind in building a necessary infrastructure for achieving goals for the country to be treated as a middle-income one. Economic governance embraces all macroeconomic, microeconomic and fiscal policies, public economic agencies, regulatory bodies, company laws and legal institutions connected with economic matters. Good governance means an efficient, open, accountable and audited public service, which has the bureaucratic competence to help design and implement appropriate public policies and, at the same time, an independent judicial system to uphold the law. Good governance is a system of governance that is able to unambiguously identify the basic values of society, where values are economic, political and socio-cultural issues including human rights, and pursue these values through an accountable and honest administration. It is obvious that good governance is a must for the development and growth of a nation. Good governance generally implies a number of institutions, which regulate the behaviour of public bodies, stimulate citizensââ¬â¢ participation in government and control public-private relations. Governance is government plus the private and third (not for profit) sectors. In the 1992 report titled ââ¬Å"Governance and Developmentâ⬠, the World Bank gave its definition of good governance. Good governance is defined as ââ¬Å"the manner in which power is exercised in the management of a countryââ¬â¢s economic and social resources for developmentâ⬠. In an October 1995 policy paper called ââ¬Å"Governance: Sound Development Managementâ⬠, the ADB outlined its policy on this topic. Further, in a separate opinion issued by the ADB General Council, it was explained that governance has at least two dimensions: (a) political (e.g., democracy, human rights); and (b) economic (e.g., efficient management of public resources). The United Nations Development Programmeââ¬â¢s (UNDP) definition of good governance is spelled out in a 1997 UNDP policy document titled ââ¬Å"Governance for Sustainable Human Developmentâ⬠. The document states that governance can be seen as the exercise of economic, political and administrative authority to manage a countryââ¬â¢s affairs at all levels. The key elements of good governance as defined by UNDP are listed below: Participation: Participation by both men and women is a key cornerstone of good governance. All men and women should have a voice in decision making either directly or through legitimate intermediate institutions that represent their interests. Rule of law: Legal frameworks should be fair and enforced impartially, particularly the laws on human rights. Transparency: Transparency is built on the free flow of information. Processes, institutions and information are directly accessible to those concerned through it, and enough information is provided to understand and monitor them. Responsiveness: Good governance requires that institutions and processes try to serve all stakeholders within a reasonable timeframe. Consensus orientation: There are several actors and as many viewpoints in a given society. Good governance requires mediation of different interests in society to reach a broad consensus on what is in the best interest of the whole community and how this can be achieved. Equity: All men and women have opportunities to improve or maintain their well-being. Effectiveness and efficiency: Good governance means that processes and institutions produce results that meet the needs of society, while making the best use of resources at their disposal. Strategic vision: Leaders and the public have a broad and long-term perspective on good governance and human development, along with a sense of what is needed for such development. There is also an understanding of the historical, cultural and social complexities, in which that perspective is grounded. The rule of law as gauged by the responses to ââ¬Ëefficient functioning of judiciaryââ¬â¢ indicates that most low and middle-income countries rate it as a much higher obstacle than their high-income counterparts. The aggregate average of street crime, organised crime, and corruption are all higher in these countries than in the developed world. There are many problems that come up as barriers to good governance. To ensure sound local development, action should be taken to work towards achieving good governance. The legal policy regime of a country provides base to the potential Foreign Direct Investment (FDI). Unequivocal, neutral legal framework and better protection of property rights can lead to higher FDI. The legal and regulatory environment does matter for financial development. Countries with legal and regulatory systems that give a high priority to creditors receive the full value of their claims on cooperation, have better- functioning financial intermediaries than countries where the legal system provides much weaker support to creditors. Bangladesh is the seventh largest country in the world in terms of its population and now it is treated as ââ¬ËN-11ââ¬â¢ after the BRICS countries. However, without progress in legal arenas, such as making suitable laws and their appropriate execution, speedy resolution of all corporate and financial disputes, and quick and transparent transfer of properties, some vital sectors of Bangladeshi economy may suffer irreparable loses. Like the infrastructural development, improvement of legal mechanism can now be regarded as the most important precondition for sustainable growth, a stronger economy, and pro-people system of governance. The writer is pursuing PhD at the Open University, Malaysia. shah@banglachemical.com
Saturday, January 11, 2020
Aegean, Roman, and Greek Cultures Essay
Aegean civilization flourished during the Bronze Age in Greece and the so-called Aegean Age. Minoan and Mycenaean civilizations were among those civilizations in the Aegean that has made its zenith during this era. Minoan civilization developed on the mountainous areas of Crete. Crete naturally possessed a wide-range of harbors which made it possible for the Minoans to settle and establish permanent livelihood as traders and merchants. From 1700 BC, they were involved in various trades including the important tin trading that is used to make bronze. Minoans focused their belief on female deities (note that Minoan women were usually appointed officials ââ¬â a symbol of respect and authority). Many archeologists believed that the Minoans have equal treatment to men and women. Evidences from Minoan artworks showed that the equal status of men and women. Minoan artworks also showed evidences of the development of the Minoan civilization (three periods of Minoan civilization ââ¬â EM, MM, and LM). Among the surviving Minoan arts is Minoan pottery. Different periods of Minoan civilization also showed different modes of design of their ceramics which include spirals in the Early Minoan, natural designs like flowers and birds during the Middle Minoan. After the demise of the Aegean civilization (during the Hittite invasion of Asia Minor), Greece began to make advances in culture. The development of the city-state allowed the propagation of culture across geography ââ¬â enabling city-states to develop its own cultural tools. It can be said that the zenith of Greek culture was during the Hellenistic period (lasted for about 200 years). The Greek Hellenistic period span from 323 B. C. up to the Battle of Actium in 31 B. C. The Hellenistic period paved the way to many transformations of Greek art. Though the Classical concepts in art were not thoroughly abandoned, the birth of the Hellenistic period made the artists create different and unique art concepts. The artists during this time explored and manipulated their imagination on their subject. It was also during this period that higher degree of Naturalism took place as a logical conclusion to great sculptors like Praxitelis and Lysipos whose works demanded for the art representation of the human figure. In a Greek art (Boy Jockey), the bold expression of energy and power during great pressure was represented. The change of focus of the Hellenistic art from religious and naturalistic ideas and concepts to human expressions, psychological concern and theatrical background, paved the way to the sculptures that includes the natural physical surroundings with creative landscaping and theatrical groupings. The Nike of Samothrace is a sculpture that embraced the true meaning and understood the world through the application of certain techniques and aesthetic conventions. The winged goddess with her outstretched wings gracefully prevents the stone from falling due to gravity. The sculpture also represented the physical human presence and the external force within it. The representation evidently speaks for the Greeks acceptance of the physical power of human being and all other external forces acting on it. Elsewhere in the Mediterranean Sea, a new power was on the rise. Roman expansion to the East resulted to: 1) consolidation of the Greek peninsula under Roman rule; 2) the destruction of Macedonia, weakening of the Seleucid Empire, and the incorporation of the states of Bithynia and Pergamum to Rome; and 3) increased Greek influence on Roman culture. Although Roman art is essentially a derivation of Greek art, it is different in two respects. First, Roman art is generally a modification of Greek art. The invention of concrete during the 1st century A. D. greatly advanced Roman art and architecture. For example, the simple amphitheatre of the Greeks was transformed into a colosseum. Concrete allowed the construction of more complex structures. Second, Greek art was essentially religious in character (this is assertion is debatable for some historians). Roman art and architecture was a mixture of religious and political philosophies. The Roman poet Ovid often referred to the Greeks as the champion of religious authority ââ¬â the center of religious worship in the Mediterranean Sea, and the Romans as the bearer of Greek culture. Here, Ovid was essentially arguing that Roman culture cannot be solely religious in nature. As the forerunner of ancient democratic institutions, Rome must distinguish itself politically from its subject peoples. With Roman domination of the Mediterranean, Greek culture spread to all parts of the Roman Empire. In the East, it became the ethos of a new cultural revival ââ¬â Greek in orientation. This revival was essentially the last if not the least of Hellenism prior to the rise of Christianity as the dominant religion in the Roman Empire. Before the Christian culture, Greek culture was the predominant mode of humanistic endeavor. However, one must understand that Greek culture was a partial derivation of Aegean culture ââ¬â a culture which is embellished in myth, tragedy, and greatness. Here, one can clearly see the development of Western culture ââ¬â a result of the transfusion of Greek culture and Christian learning.
Subscribe to:
Posts (Atom)